ID: 1158285950

View in Genome Browser
Species Human (GRCh38)
Location 18:55883078-55883100
Sequence CATCTACCCAGAACACCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158285949_1158285950 -6 Left 1158285949 18:55883061-55883083 CCTTGTGGAAGACTCTTCATCTA 0: 1
1: 0
2: 1
3: 10
4: 158
Right 1158285950 18:55883078-55883100 CATCTACCCAGAACACCGTATGG 0: 1
1: 0
2: 0
3: 3
4: 77
1158285947_1158285950 4 Left 1158285947 18:55883051-55883073 CCCTGAAATACCTTGTGGAAGAC 0: 1
1: 0
2: 1
3: 15
4: 154
Right 1158285950 18:55883078-55883100 CATCTACCCAGAACACCGTATGG 0: 1
1: 0
2: 0
3: 3
4: 77
1158285945_1158285950 12 Left 1158285945 18:55883043-55883065 CCACAGATCCCTGAAATACCTTG 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1158285950 18:55883078-55883100 CATCTACCCAGAACACCGTATGG 0: 1
1: 0
2: 0
3: 3
4: 77
1158285948_1158285950 3 Left 1158285948 18:55883052-55883074 CCTGAAATACCTTGTGGAAGACT 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1158285950 18:55883078-55883100 CATCTACCCAGAACACCGTATGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158285950 Original CRISPR CATCTACCCAGAACACCGTA TGG Intergenic
900355619 1:2261647-2261669 CATCTACACAGAAAACCCAATGG - Intronic
905884819 1:41485921-41485943 CACCTACCCTGCACACAGTAGGG + Intergenic
906143698 1:43548001-43548023 CACCTACCCAGCACACCCTGTGG - Intronic
912214575 1:107593433-107593455 CCTCTACTCAGAACACAGAATGG + Intronic
920246709 1:204593308-204593330 CACAAACCCAGAACACCGTTGGG - Intergenic
921714964 1:218408303-218408325 CATCTACCAAGAACTCACTAAGG - Intronic
924870371 1:248036724-248036746 CCTCTACCCAGAAAACTGTCAGG + Intronic
1066488291 10:35870472-35870494 AATCTGCCCGGAACACAGTACGG - Intergenic
1067034877 10:42906797-42906819 CATATACCTAGAAAACCATAAGG + Intergenic
1068472093 10:57478387-57478409 CATCTACCCAGAAGACTAGAAGG + Intergenic
1075218351 10:120560002-120560024 TATCTACCTAAAACACCGTGTGG + Intronic
1082564229 11:54656759-54656781 AATCTACCCAGAGCACAGTTGGG + Intergenic
1086364025 11:86089851-86089873 GATCTACCCTGGACACAGTAGGG + Intergenic
1087740991 11:101886783-101886805 CATATACCCCAAACACTGTAAGG - Intergenic
1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG + Intronic
1089912835 11:122119830-122119852 CATGTAACCAGAACATCTTAAGG + Intergenic
1091900571 12:4141024-4141046 CATCTACCCAAAACTCCTCAGGG + Intergenic
1094394384 12:29990314-29990336 CATCTTCTCAGAACACGGCAGGG + Intergenic
1097846710 12:64374074-64374096 CATCTACCCAGACTTCCTTAGGG - Intronic
1098184152 12:67878626-67878648 CATCTACACAGCCCACCTTAAGG - Intergenic
1107175932 13:37397918-37397940 CATTTACCCAAAACTCCTTAAGG - Intergenic
1120481162 14:85051477-85051499 TGTCTACCCAGAACACTGAACGG + Intergenic
1121768680 14:96510768-96510790 CACTTACACAGAACACCTTACGG + Intronic
1124634886 15:31358956-31358978 CATCTTCCCTGAGCACGGTAGGG - Intronic
1127658699 15:61080005-61080027 CATGTGCCCAGCACACAGTAAGG + Intronic
1130746780 15:86662969-86662991 CATCTTCCAAGAACACTGGATGG + Intronic
1135033744 16:19059532-19059554 CATTTACCCAGGACACTGCAAGG + Intronic
1144431641 17:15198138-15198160 CATCTACACAGAAAACCTGATGG + Intergenic
1144887795 17:18475774-18475796 CATCTAGGCAGAACACAGGAAGG + Intergenic
1145144417 17:20468526-20468548 CATCTAGGCAGAACACAGGAAGG - Intergenic
1152489154 17:80617686-80617708 CCTCTACCCGAAACACCTTATGG - Intronic
1158285950 18:55883078-55883100 CATCTACCCAGAACACCGTATGG + Intergenic
1160553140 18:79708184-79708206 CATCTTCCCAGAAGATCTTACGG + Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1168270839 19:55248915-55248937 CATCCACCCTGACCACCCTAAGG + Intronic
930714202 2:54577331-54577353 CATCTACCCAGAAGAGCCTTGGG - Intronic
939780391 2:146439320-146439342 TATCTTCCCTGAACACCATATGG + Intergenic
940308683 2:152253861-152253883 CTTCAACACAGAACACTGTAAGG + Intergenic
942789763 2:179747280-179747302 CATCTAACCAGCAGCCCGTAAGG - Intronic
943890951 2:193286452-193286474 CATTTACCTTGAAAACCGTAAGG - Intergenic
1169346441 20:4832141-4832163 CATTTTCCCAGAACATAGTATGG - Intergenic
1169394670 20:5219043-5219065 TCTCTACCTAGAACCCCGTAGGG + Intergenic
1175506800 20:59491899-59491921 CATCTACCCAGCAGACCTGAAGG + Intergenic
1178948598 21:36967405-36967427 CATGTAGCAAGAACACCATAGGG - Intronic
1184309762 22:43633715-43633737 CATCTGCCCACCACACCGTGGGG - Intronic
949850604 3:8416679-8416701 CAATCACCCAGAACACTGTATGG + Intergenic
952493389 3:33893872-33893894 CATATACCTAGAAAACCCTAAGG - Intergenic
952975099 3:38687136-38687158 CATCTACTCAGAGCACCCTGGGG + Intergenic
960918293 3:122719870-122719892 CAACTACTTAGAACACTGTAGGG + Intronic
965003283 3:162985808-162985830 CATCTGCCAAGAACATCTTATGG + Intergenic
966836903 3:184056323-184056345 CATCTGCCGAGAACAGCCTAGGG + Intronic
968595762 4:1482263-1482285 CATCTACACAGAAAATCCTATGG - Intergenic
969637221 4:8376459-8376481 AATCTTCCCAGAACACAGCAGGG + Intronic
976522619 4:86046843-86046865 CAACTACCTAGAACACTGTCTGG - Intronic
977125649 4:93164099-93164121 CATCTAGCCAGAATACATTAAGG - Intronic
977562013 4:98542127-98542149 CATCTTCACAGAACCCCGTCAGG - Intronic
979229478 4:118330614-118330636 CATCTGCCAAGGACACTGTAGGG + Intronic
982140876 4:152316652-152316674 CATCCAGCAAGAACACAGTATGG - Intergenic
986949597 5:13066841-13066863 CATCTATCCACAAGACCATAGGG - Intergenic
995380628 5:111529071-111529093 CATCTACCTAGAAAACCCTATGG + Intergenic
995469360 5:112484318-112484340 CAGCTTCCCAGAACACAGCAGGG - Intergenic
998723197 5:144977037-144977059 CATCTACCCAGACCACCCAATGG - Intergenic
1000852522 5:166357677-166357699 AATCTACCCAGAAGATCCTAGGG - Intergenic
1009522721 6:64705062-64705084 CGTTTACCTAGAATACCGTAAGG + Intronic
1013310669 6:108890678-108890700 CATATACCCACCACAACGTAAGG + Intronic
1013366684 6:109442572-109442594 CATCTACCTAGCACATCGTGTGG + Exonic
1017895988 6:158680298-158680320 CATCAACACAAAACACCTTAAGG - Intronic
1019901830 7:4026960-4026982 CATCTATCCAGAACACAGCAGGG - Intronic
1021554905 7:21909398-21909420 AATCTACCAAGAACACGGAATGG + Intronic
1022384540 7:29889032-29889054 CTTCAACCAATAACACCGTAAGG - Intronic
1027881825 7:83849215-83849237 CATGTATCCACAACACTGTATGG - Intergenic
1028774882 7:94665118-94665140 CGTCTACCCAGATCACCGCCTGG + Exonic
1039232205 8:35460780-35460802 CATATGCCCAGAACACAGCAAGG - Intronic
1047543125 8:125790022-125790044 CATCTCCCCAGGACCCCATAAGG + Intergenic
1047901492 8:129427263-129427285 CATATACCTAGAAAACCCTAAGG - Intergenic
1050428892 9:5541439-5541461 CATATACCTAGAAAACCCTAAGG + Intronic
1058099433 9:100902602-100902624 CATCTACCGAACACACCCTATGG - Intergenic
1058134016 9:101287480-101287502 AATCTACCCAAAACCCTGTAAGG + Intronic
1058337359 9:103847320-103847342 CATCTAACCAGTACCCCCTAAGG + Intergenic
1195015736 X:100778519-100778541 CATCTACCTTGAAAACCCTAAGG - Intergenic
1199717847 X:150518878-150518900 CATCTTCCCAGAATACAGAAAGG - Intergenic