ID: 1158289085

View in Genome Browser
Species Human (GRCh38)
Location 18:55918574-55918596
Sequence CCGCAATGTGCAGCGTGTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158289085_1158289090 17 Left 1158289085 18:55918574-55918596 CCGGTACACGCTGCACATTGCGG No data
Right 1158289090 18:55918614-55918636 CAGAGCCTCTGCCTCACAGCTGG No data
1158289085_1158289093 25 Left 1158289085 18:55918574-55918596 CCGGTACACGCTGCACATTGCGG No data
Right 1158289093 18:55918622-55918644 CTGCCTCACAGCTGGGCTGAAGG No data
1158289085_1158289091 18 Left 1158289085 18:55918574-55918596 CCGGTACACGCTGCACATTGCGG No data
Right 1158289091 18:55918615-55918637 AGAGCCTCTGCCTCACAGCTGGG No data
1158289085_1158289088 -9 Left 1158289085 18:55918574-55918596 CCGGTACACGCTGCACATTGCGG No data
Right 1158289088 18:55918588-55918610 ACATTGCGGCGGTCTCACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158289085 Original CRISPR CCGCAATGTGCAGCGTGTAC CGG (reversed) Intergenic
No off target data available for this crispr