ID: 1158291970

View in Genome Browser
Species Human (GRCh38)
Location 18:55953437-55953459
Sequence GTGATGGCCCTGAGTATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158291964_1158291970 14 Left 1158291964 18:55953400-55953422 CCGAGCCAGGCCAAGAGATAAAA 0: 8
1: 2
2: 13
3: 35
4: 349
Right 1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG No data
1158291966_1158291970 4 Left 1158291966 18:55953410-55953432 CCAAGAGATAAAATCAGCTCTAG No data
Right 1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG No data
1158291965_1158291970 9 Left 1158291965 18:55953405-55953427 CCAGGCCAAGAGATAAAATCAGC No data
Right 1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158291970 Original CRISPR GTGATGGCCCTGAGTATGGG AGG Intergenic
No off target data available for this crispr