ID: 1158297984

View in Genome Browser
Species Human (GRCh38)
Location 18:56020350-56020372
Sequence TGGAGTAAATGAAGAATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158297984_1158297986 -1 Left 1158297984 18:56020350-56020372 CCTGAGATTCTTCATTTACTCCA No data
Right 1158297986 18:56020372-56020394 AATATCTTAAATATGATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158297984 Original CRISPR TGGAGTAAATGAAGAATCTC AGG (reversed) Intergenic
No off target data available for this crispr