ID: 1158303202

View in Genome Browser
Species Human (GRCh38)
Location 18:56075832-56075854
Sequence GGTGGGTTATGATACATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158303194_1158303202 12 Left 1158303194 18:56075797-56075819 CCTCCTAAAAACTCTGGAGAGAA No data
Right 1158303202 18:56075832-56075854 GGTGGGTTATGATACATAAAAGG No data
1158303192_1158303202 19 Left 1158303192 18:56075790-56075812 CCTAATGCCTCCTAAAAACTCTG No data
Right 1158303202 18:56075832-56075854 GGTGGGTTATGATACATAAAAGG No data
1158303195_1158303202 9 Left 1158303195 18:56075800-56075822 CCTAAAAACTCTGGAGAGAAATT No data
Right 1158303202 18:56075832-56075854 GGTGGGTTATGATACATAAAAGG No data
1158303191_1158303202 23 Left 1158303191 18:56075786-56075808 CCTGCCTAATGCCTCCTAAAAAC No data
Right 1158303202 18:56075832-56075854 GGTGGGTTATGATACATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158303202 Original CRISPR GGTGGGTTATGATACATAAA AGG Intergenic
No off target data available for this crispr