ID: 1158308043

View in Genome Browser
Species Human (GRCh38)
Location 18:56128017-56128039
Sequence CTGACATAAGGGCTGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158308043_1158308051 6 Left 1158308043 18:56128017-56128039 CCACCCACCAGCCCTTATGTCAG No data
Right 1158308051 18:56128046-56128068 GGCACAAACAACATCATTAAAGG No data
1158308043_1158308052 11 Left 1158308043 18:56128017-56128039 CCACCCACCAGCCCTTATGTCAG No data
Right 1158308052 18:56128051-56128073 AAACAACATCATTAAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158308043 Original CRISPR CTGACATAAGGGCTGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr