ID: 1158318515 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:56238016-56238038 |
Sequence | TTGAAGCTGGCTCATACTGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158318515_1158318519 | -5 | Left | 1158318515 | 18:56238016-56238038 | CCCACAGTATGAGCCAGCTTCAA | No data | ||
Right | 1158318519 | 18:56238034-56238056 | TTCAACCATCTCCCTGACTTGGG | No data | ||||
1158318515_1158318523 | 26 | Left | 1158318515 | 18:56238016-56238038 | CCCACAGTATGAGCCAGCTTCAA | No data | ||
Right | 1158318523 | 18:56238065-56238087 | CTCTAGCTTCCGATTGTGCCTGG | No data | ||||
1158318515_1158318518 | -6 | Left | 1158318515 | 18:56238016-56238038 | CCCACAGTATGAGCCAGCTTCAA | No data | ||
Right | 1158318518 | 18:56238033-56238055 | CTTCAACCATCTCCCTGACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158318515 | Original CRISPR | TTGAAGCTGGCTCATACTGT GGG (reversed) | Intergenic | ||