ID: 1158318515

View in Genome Browser
Species Human (GRCh38)
Location 18:56238016-56238038
Sequence TTGAAGCTGGCTCATACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318515_1158318519 -5 Left 1158318515 18:56238016-56238038 CCCACAGTATGAGCCAGCTTCAA No data
Right 1158318519 18:56238034-56238056 TTCAACCATCTCCCTGACTTGGG No data
1158318515_1158318523 26 Left 1158318515 18:56238016-56238038 CCCACAGTATGAGCCAGCTTCAA No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data
1158318515_1158318518 -6 Left 1158318515 18:56238016-56238038 CCCACAGTATGAGCCAGCTTCAA No data
Right 1158318518 18:56238033-56238055 CTTCAACCATCTCCCTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318515 Original CRISPR TTGAAGCTGGCTCATACTGT GGG (reversed) Intergenic