ID: 1158318517

View in Genome Browser
Species Human (GRCh38)
Location 18:56238029-56238051
Sequence GTCAGGGAGATGGTTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318517_1158318523 13 Left 1158318517 18:56238029-56238051 CCAGCTTCAACCATCTCCCTGAC No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318517 Original CRISPR GTCAGGGAGATGGTTGAAGC TGG (reversed) Intergenic