ID: 1158318518

View in Genome Browser
Species Human (GRCh38)
Location 18:56238033-56238055
Sequence CTTCAACCATCTCCCTGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318515_1158318518 -6 Left 1158318515 18:56238016-56238038 CCCACAGTATGAGCCAGCTTCAA No data
Right 1158318518 18:56238033-56238055 CTTCAACCATCTCCCTGACTTGG No data
1158318512_1158318518 23 Left 1158318512 18:56237987-56238009 CCCCAGGGAAGAAGGTGGTCTCT No data
Right 1158318518 18:56238033-56238055 CTTCAACCATCTCCCTGACTTGG No data
1158318514_1158318518 21 Left 1158318514 18:56237989-56238011 CCAGGGAAGAAGGTGGTCTCTTC No data
Right 1158318518 18:56238033-56238055 CTTCAACCATCTCCCTGACTTGG No data
1158318516_1158318518 -7 Left 1158318516 18:56238017-56238039 CCACAGTATGAGCCAGCTTCAAC No data
Right 1158318518 18:56238033-56238055 CTTCAACCATCTCCCTGACTTGG No data
1158318513_1158318518 22 Left 1158318513 18:56237988-56238010 CCCAGGGAAGAAGGTGGTCTCTT No data
Right 1158318518 18:56238033-56238055 CTTCAACCATCTCCCTGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318518 Original CRISPR CTTCAACCATCTCCCTGACT TGG Intergenic