ID: 1158318520

View in Genome Browser
Species Human (GRCh38)
Location 18:56238039-56238061
Sequence TGTGACCCAAGTCAGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318520_1158318523 3 Left 1158318520 18:56238039-56238061 CCATCTCCCTGACTTGGGTCACA No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data
1158318520_1158318526 23 Left 1158318520 18:56238039-56238061 CCATCTCCCTGACTTGGGTCACA No data
Right 1158318526 18:56238085-56238107 TGGCCTGCTTAAAAAGCATCAGG No data
1158318520_1158318527 24 Left 1158318520 18:56238039-56238061 CCATCTCCCTGACTTGGGTCACA No data
Right 1158318527 18:56238086-56238108 GGCCTGCTTAAAAAGCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318520 Original CRISPR TGTGACCCAAGTCAGGGAGA TGG (reversed) Intergenic