ID: 1158318521

View in Genome Browser
Species Human (GRCh38)
Location 18:56238045-56238067
Sequence GAGAGCTGTGACCCAAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318521_1158318527 18 Left 1158318521 18:56238045-56238067 CCCTGACTTGGGTCACAGCTCTC No data
Right 1158318527 18:56238086-56238108 GGCCTGCTTAAAAAGCATCAGGG No data
1158318521_1158318526 17 Left 1158318521 18:56238045-56238067 CCCTGACTTGGGTCACAGCTCTC No data
Right 1158318526 18:56238085-56238107 TGGCCTGCTTAAAAAGCATCAGG No data
1158318521_1158318529 27 Left 1158318521 18:56238045-56238067 CCCTGACTTGGGTCACAGCTCTC No data
Right 1158318529 18:56238095-56238117 AAAAAGCATCAGGGTGAGTGTGG No data
1158318521_1158318523 -3 Left 1158318521 18:56238045-56238067 CCCTGACTTGGGTCACAGCTCTC No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318521 Original CRISPR GAGAGCTGTGACCCAAGTCA GGG (reversed) Intergenic