ID: 1158318522

View in Genome Browser
Species Human (GRCh38)
Location 18:56238046-56238068
Sequence AGAGAGCTGTGACCCAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318522_1158318526 16 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318526 18:56238085-56238107 TGGCCTGCTTAAAAAGCATCAGG No data
1158318522_1158318529 26 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318529 18:56238095-56238117 AAAAAGCATCAGGGTGAGTGTGG No data
1158318522_1158318523 -4 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data
1158318522_1158318527 17 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318527 18:56238086-56238108 GGCCTGCTTAAAAAGCATCAGGG No data
1158318522_1158318530 30 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318530 18:56238099-56238121 AGCATCAGGGTGAGTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318522 Original CRISPR AGAGAGCTGTGACCCAAGTC AGG (reversed) Intergenic
No off target data available for this crispr