ID: 1158318523

View in Genome Browser
Species Human (GRCh38)
Location 18:56238065-56238087
Sequence CTCTAGCTTCCGATTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318517_1158318523 13 Left 1158318517 18:56238029-56238051 CCAGCTTCAACCATCTCCCTGAC No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data
1158318516_1158318523 25 Left 1158318516 18:56238017-56238039 CCACAGTATGAGCCAGCTTCAAC No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data
1158318520_1158318523 3 Left 1158318520 18:56238039-56238061 CCATCTCCCTGACTTGGGTCACA No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data
1158318521_1158318523 -3 Left 1158318521 18:56238045-56238067 CCCTGACTTGGGTCACAGCTCTC No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data
1158318515_1158318523 26 Left 1158318515 18:56238016-56238038 CCCACAGTATGAGCCAGCTTCAA No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data
1158318522_1158318523 -4 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318523 18:56238065-56238087 CTCTAGCTTCCGATTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318523 Original CRISPR CTCTAGCTTCCGATTGTGCC TGG Intergenic