ID: 1158318524

View in Genome Browser
Species Human (GRCh38)
Location 18:56238074-56238096
Sequence TTAAGCAGGCCAGGCACAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318524_1158318530 2 Left 1158318524 18:56238074-56238096 CCGATTGTGCCTGGCCTGCTTAA No data
Right 1158318530 18:56238099-56238121 AGCATCAGGGTGAGTGTGGATGG No data
1158318524_1158318532 27 Left 1158318524 18:56238074-56238096 CCGATTGTGCCTGGCCTGCTTAA No data
Right 1158318532 18:56238124-56238146 CCAAGTGAGCATGAGCAGACTGG No data
1158318524_1158318529 -2 Left 1158318524 18:56238074-56238096 CCGATTGTGCCTGGCCTGCTTAA No data
Right 1158318529 18:56238095-56238117 AAAAAGCATCAGGGTGAGTGTGG No data
1158318524_1158318533 30 Left 1158318524 18:56238074-56238096 CCGATTGTGCCTGGCCTGCTTAA No data
Right 1158318533 18:56238127-56238149 AGTGAGCATGAGCAGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318524 Original CRISPR TTAAGCAGGCCAGGCACAAT CGG (reversed) Intergenic