ID: 1158318526

View in Genome Browser
Species Human (GRCh38)
Location 18:56238085-56238107
Sequence TGGCCTGCTTAAAAAGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318521_1158318526 17 Left 1158318521 18:56238045-56238067 CCCTGACTTGGGTCACAGCTCTC No data
Right 1158318526 18:56238085-56238107 TGGCCTGCTTAAAAAGCATCAGG No data
1158318522_1158318526 16 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318526 18:56238085-56238107 TGGCCTGCTTAAAAAGCATCAGG No data
1158318520_1158318526 23 Left 1158318520 18:56238039-56238061 CCATCTCCCTGACTTGGGTCACA No data
Right 1158318526 18:56238085-56238107 TGGCCTGCTTAAAAAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318526 Original CRISPR TGGCCTGCTTAAAAAGCATC AGG Intergenic