ID: 1158318527

View in Genome Browser
Species Human (GRCh38)
Location 18:56238086-56238108
Sequence GGCCTGCTTAAAAAGCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318521_1158318527 18 Left 1158318521 18:56238045-56238067 CCCTGACTTGGGTCACAGCTCTC No data
Right 1158318527 18:56238086-56238108 GGCCTGCTTAAAAAGCATCAGGG No data
1158318522_1158318527 17 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318527 18:56238086-56238108 GGCCTGCTTAAAAAGCATCAGGG No data
1158318520_1158318527 24 Left 1158318520 18:56238039-56238061 CCATCTCCCTGACTTGGGTCACA No data
Right 1158318527 18:56238086-56238108 GGCCTGCTTAAAAAGCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318527 Original CRISPR GGCCTGCTTAAAAAGCATCA GGG Intergenic