ID: 1158318528

View in Genome Browser
Species Human (GRCh38)
Location 18:56238088-56238110
Sequence CACCCTGATGCTTTTTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318528_1158318537 29 Left 1158318528 18:56238088-56238110 CCTGCTTAAAAAGCATCAGGGTG No data
Right 1158318537 18:56238140-56238162 AGACTGGAGGATGATGGGGTCGG No data
1158318528_1158318534 23 Left 1158318528 18:56238088-56238110 CCTGCTTAAAAAGCATCAGGGTG No data
Right 1158318534 18:56238134-56238156 ATGAGCAGACTGGAGGATGATGG No data
1158318528_1158318535 24 Left 1158318528 18:56238088-56238110 CCTGCTTAAAAAGCATCAGGGTG No data
Right 1158318535 18:56238135-56238157 TGAGCAGACTGGAGGATGATGGG No data
1158318528_1158318536 25 Left 1158318528 18:56238088-56238110 CCTGCTTAAAAAGCATCAGGGTG No data
Right 1158318536 18:56238136-56238158 GAGCAGACTGGAGGATGATGGGG No data
1158318528_1158318533 16 Left 1158318528 18:56238088-56238110 CCTGCTTAAAAAGCATCAGGGTG No data
Right 1158318533 18:56238127-56238149 AGTGAGCATGAGCAGACTGGAGG No data
1158318528_1158318532 13 Left 1158318528 18:56238088-56238110 CCTGCTTAAAAAGCATCAGGGTG No data
Right 1158318532 18:56238124-56238146 CCAAGTGAGCATGAGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318528 Original CRISPR CACCCTGATGCTTTTTAAGC AGG (reversed) Intergenic
No off target data available for this crispr