ID: 1158318529

View in Genome Browser
Species Human (GRCh38)
Location 18:56238095-56238117
Sequence AAAAAGCATCAGGGTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318521_1158318529 27 Left 1158318521 18:56238045-56238067 CCCTGACTTGGGTCACAGCTCTC No data
Right 1158318529 18:56238095-56238117 AAAAAGCATCAGGGTGAGTGTGG No data
1158318524_1158318529 -2 Left 1158318524 18:56238074-56238096 CCGATTGTGCCTGGCCTGCTTAA No data
Right 1158318529 18:56238095-56238117 AAAAAGCATCAGGGTGAGTGTGG No data
1158318522_1158318529 26 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318529 18:56238095-56238117 AAAAAGCATCAGGGTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318529 Original CRISPR AAAAAGCATCAGGGTGAGTG TGG Intergenic
No off target data available for this crispr