ID: 1158318530

View in Genome Browser
Species Human (GRCh38)
Location 18:56238099-56238121
Sequence AGCATCAGGGTGAGTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318522_1158318530 30 Left 1158318522 18:56238046-56238068 CCTGACTTGGGTCACAGCTCTCT No data
Right 1158318530 18:56238099-56238121 AGCATCAGGGTGAGTGTGGATGG No data
1158318524_1158318530 2 Left 1158318524 18:56238074-56238096 CCGATTGTGCCTGGCCTGCTTAA No data
Right 1158318530 18:56238099-56238121 AGCATCAGGGTGAGTGTGGATGG No data
1158318525_1158318530 -7 Left 1158318525 18:56238083-56238105 CCTGGCCTGCTTAAAAAGCATCA No data
Right 1158318530 18:56238099-56238121 AGCATCAGGGTGAGTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318530 Original CRISPR AGCATCAGGGTGAGTGTGGA TGG Intergenic
No off target data available for this crispr