ID: 1158318534

View in Genome Browser
Species Human (GRCh38)
Location 18:56238134-56238156
Sequence ATGAGCAGACTGGAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318525_1158318534 28 Left 1158318525 18:56238083-56238105 CCTGGCCTGCTTAAAAAGCATCA No data
Right 1158318534 18:56238134-56238156 ATGAGCAGACTGGAGGATGATGG No data
1158318528_1158318534 23 Left 1158318528 18:56238088-56238110 CCTGCTTAAAAAGCATCAGGGTG No data
Right 1158318534 18:56238134-56238156 ATGAGCAGACTGGAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318534 Original CRISPR ATGAGCAGACTGGAGGATGA TGG Intergenic
No off target data available for this crispr