ID: 1158318537

View in Genome Browser
Species Human (GRCh38)
Location 18:56238140-56238162
Sequence AGACTGGAGGATGATGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158318528_1158318537 29 Left 1158318528 18:56238088-56238110 CCTGCTTAAAAAGCATCAGGGTG No data
Right 1158318537 18:56238140-56238162 AGACTGGAGGATGATGGGGTCGG No data
1158318531_1158318537 -7 Left 1158318531 18:56238124-56238146 CCAAGTGAGCATGAGCAGACTGG No data
Right 1158318537 18:56238140-56238162 AGACTGGAGGATGATGGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158318537 Original CRISPR AGACTGGAGGATGATGGGGT CGG Intergenic
No off target data available for this crispr