ID: 1158319192

View in Genome Browser
Species Human (GRCh38)
Location 18:56244699-56244721
Sequence CCTTTGCCTCTATTCCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158319190_1158319192 28 Left 1158319190 18:56244648-56244670 CCAGGGTACACAGCAAGGAGCGA No data
Right 1158319192 18:56244699-56244721 CCTTTGCCTCTATTCCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158319192 Original CRISPR CCTTTGCCTCTATTCCACCA TGG Intergenic
No off target data available for this crispr