ID: 1158321446 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:56268536-56268558 |
Sequence | TTCTTTGAAGAGATGGAGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1158321446_1158321452 | 28 | Left | 1158321446 | 18:56268536-56268558 | CCCAGCTCCATCTCTTCAAAGAA | No data | ||
Right | 1158321452 | 18:56268587-56268609 | AGGTTACAGCTCCTGTTAGAAGG | No data | ||||
1158321446_1158321451 | 8 | Left | 1158321446 | 18:56268536-56268558 | CCCAGCTCCATCTCTTCAAAGAA | No data | ||
Right | 1158321451 | 18:56268567-56268589 | TGGATGTGTCTCTCTACTACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1158321446 | Original CRISPR | TTCTTTGAAGAGATGGAGCT GGG (reversed) | Intergenic | ||
No off target data available for this crispr |