ID: 1158321446

View in Genome Browser
Species Human (GRCh38)
Location 18:56268536-56268558
Sequence TTCTTTGAAGAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158321446_1158321452 28 Left 1158321446 18:56268536-56268558 CCCAGCTCCATCTCTTCAAAGAA No data
Right 1158321452 18:56268587-56268609 AGGTTACAGCTCCTGTTAGAAGG No data
1158321446_1158321451 8 Left 1158321446 18:56268536-56268558 CCCAGCTCCATCTCTTCAAAGAA No data
Right 1158321451 18:56268567-56268589 TGGATGTGTCTCTCTACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158321446 Original CRISPR TTCTTTGAAGAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr