ID: 1158322886

View in Genome Browser
Species Human (GRCh38)
Location 18:56282661-56282683
Sequence GTGCCCTGCCCATATTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158322884_1158322886 4 Left 1158322884 18:56282634-56282656 CCTGGATAAGGTATGAGGTCATT No data
Right 1158322886 18:56282661-56282683 GTGCCCTGCCCATATTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158322886 Original CRISPR GTGCCCTGCCCATATTCCCA GGG Intergenic
No off target data available for this crispr