ID: 1158323452

View in Genome Browser
Species Human (GRCh38)
Location 18:56289054-56289076
Sequence AAGGATAAACAGATGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158323448_1158323452 -4 Left 1158323448 18:56289035-56289057 CCAAAAAATGAAGGTGGGGAAGG No data
Right 1158323452 18:56289054-56289076 AAGGATAAACAGATGGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158323452 Original CRISPR AAGGATAAACAGATGGGTCA AGG Intergenic
No off target data available for this crispr