ID: 1158324974

View in Genome Browser
Species Human (GRCh38)
Location 18:56303764-56303786
Sequence CACCAAATCCTGCCTCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158324974_1158324975 -9 Left 1158324974 18:56303764-56303786 CCAATGAGAGGCAGGATTTGGTG No data
Right 1158324975 18:56303778-56303800 GATTTGGTGATTAAATACCAAGG No data
1158324974_1158324976 -8 Left 1158324974 18:56303764-56303786 CCAATGAGAGGCAGGATTTGGTG No data
Right 1158324976 18:56303779-56303801 ATTTGGTGATTAAATACCAAGGG No data
1158324974_1158324978 13 Left 1158324974 18:56303764-56303786 CCAATGAGAGGCAGGATTTGGTG No data
Right 1158324978 18:56303800-56303822 GGCACTCTCATTTCACTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158324974 Original CRISPR CACCAAATCCTGCCTCTCAT TGG (reversed) Intergenic
No off target data available for this crispr