ID: 1158325236

View in Genome Browser
Species Human (GRCh38)
Location 18:56306765-56306787
Sequence GTTAAGTGTATTTCCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158325236_1158325239 12 Left 1158325236 18:56306765-56306787 CCCAGGAGGGAAATACACTTAAC No data
Right 1158325239 18:56306800-56306822 GTGTGAGCAAACCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158325236 Original CRISPR GTTAAGTGTATTTCCCTCCT GGG (reversed) Intergenic
No off target data available for this crispr