ID: 1158325237

View in Genome Browser
Species Human (GRCh38)
Location 18:56306766-56306788
Sequence AGTTAAGTGTATTTCCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158325237_1158325239 11 Left 1158325237 18:56306766-56306788 CCAGGAGGGAAATACACTTAACT No data
Right 1158325239 18:56306800-56306822 GTGTGAGCAAACCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158325237 Original CRISPR AGTTAAGTGTATTTCCCTCC TGG (reversed) Intergenic
No off target data available for this crispr