ID: 1158325239

View in Genome Browser
Species Human (GRCh38)
Location 18:56306800-56306822
Sequence GTGTGAGCAAACCCTCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158325234_1158325239 14 Left 1158325234 18:56306763-56306785 CCCCCAGGAGGGAAATACACTTA No data
Right 1158325239 18:56306800-56306822 GTGTGAGCAAACCCTCCAACAGG No data
1158325236_1158325239 12 Left 1158325236 18:56306765-56306787 CCCAGGAGGGAAATACACTTAAC No data
Right 1158325239 18:56306800-56306822 GTGTGAGCAAACCCTCCAACAGG No data
1158325237_1158325239 11 Left 1158325237 18:56306766-56306788 CCAGGAGGGAAATACACTTAACT No data
Right 1158325239 18:56306800-56306822 GTGTGAGCAAACCCTCCAACAGG No data
1158325235_1158325239 13 Left 1158325235 18:56306764-56306786 CCCCAGGAGGGAAATACACTTAA No data
Right 1158325239 18:56306800-56306822 GTGTGAGCAAACCCTCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158325239 Original CRISPR GTGTGAGCAAACCCTCCAAC AGG Intergenic
No off target data available for this crispr