ID: 1158326606

View in Genome Browser
Species Human (GRCh38)
Location 18:56319826-56319848
Sequence CTCTGGTTCTGGAGTTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158326606_1158326611 28 Left 1158326606 18:56319826-56319848 CCTTCTGAACTCCAGAACCAGAG No data
Right 1158326611 18:56319877-56319899 AGCCCTCCATTTTGAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158326606 Original CRISPR CTCTGGTTCTGGAGTTCAGA AGG (reversed) Intergenic
No off target data available for this crispr