ID: 1158332376

View in Genome Browser
Species Human (GRCh38)
Location 18:56376734-56376756
Sequence CCCCTTTAGCAGAGTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158332376_1158332379 -7 Left 1158332376 18:56376734-56376756 CCAAGCTGACTCTGCTAAAGGGG No data
Right 1158332379 18:56376750-56376772 AAAGGGGTATGCAGACAGAAGGG No data
1158332376_1158332378 -8 Left 1158332376 18:56376734-56376756 CCAAGCTGACTCTGCTAAAGGGG No data
Right 1158332378 18:56376749-56376771 TAAAGGGGTATGCAGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158332376 Original CRISPR CCCCTTTAGCAGAGTCAGCT TGG (reversed) Intergenic
No off target data available for this crispr