ID: 1158346355

View in Genome Browser
Species Human (GRCh38)
Location 18:56520656-56520678
Sequence TCATTGGTCCACCTAGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158346355_1158346369 30 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346369 18:56520709-56520731 GAATTTAAGGTTTTTAAAACAGG No data
1158346355_1158346363 2 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG No data
1158346355_1158346365 4 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346365 18:56520683-56520705 GAGGGAGAGGGATGTGGAAGGGG No data
1158346355_1158346362 -2 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346362 18:56520677-56520699 GATGCTGAGGGAGAGGGATGTGG No data
1158346355_1158346366 5 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346366 18:56520684-56520706 AGGGAGAGGGATGTGGAAGGGGG No data
1158346355_1158346367 8 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346367 18:56520687-56520709 GAGAGGGATGTGGAAGGGGGAGG No data
1158346355_1158346359 -9 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346359 18:56520670-56520692 GACCAATGATGCTGAGGGAGAGG No data
1158346355_1158346360 -8 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346360 18:56520671-56520693 ACCAATGATGCTGAGGGAGAGGG No data
1158346355_1158346364 3 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346364 18:56520682-56520704 TGAGGGAGAGGGATGTGGAAGGG No data
1158346355_1158346368 17 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346368 18:56520696-56520718 GTGGAAGGGGGAGGAATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158346355 Original CRISPR TCATTGGTCCACCTAGCATA GGG (reversed) Intergenic
No off target data available for this crispr