ID: 1158346356

View in Genome Browser
Species Human (GRCh38)
Location 18:56520657-56520679
Sequence ATCATTGGTCCACCTAGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158346356_1158346368 16 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346368 18:56520696-56520718 GTGGAAGGGGGAGGAATTTAAGG No data
1158346356_1158346363 1 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG No data
1158346356_1158346369 29 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346369 18:56520709-56520731 GAATTTAAGGTTTTTAAAACAGG No data
1158346356_1158346359 -10 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346359 18:56520670-56520692 GACCAATGATGCTGAGGGAGAGG No data
1158346356_1158346366 4 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346366 18:56520684-56520706 AGGGAGAGGGATGTGGAAGGGGG No data
1158346356_1158346360 -9 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346360 18:56520671-56520693 ACCAATGATGCTGAGGGAGAGGG No data
1158346356_1158346362 -3 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346362 18:56520677-56520699 GATGCTGAGGGAGAGGGATGTGG No data
1158346356_1158346367 7 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346367 18:56520687-56520709 GAGAGGGATGTGGAAGGGGGAGG No data
1158346356_1158346364 2 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346364 18:56520682-56520704 TGAGGGAGAGGGATGTGGAAGGG No data
1158346356_1158346365 3 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346365 18:56520683-56520705 GAGGGAGAGGGATGTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158346356 Original CRISPR ATCATTGGTCCACCTAGCAT AGG (reversed) Intergenic
No off target data available for this crispr