ID: 1158346363

View in Genome Browser
Species Human (GRCh38)
Location 18:56520681-56520703
Sequence CTGAGGGAGAGGGATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158346356_1158346363 1 Left 1158346356 18:56520657-56520679 CCTATGCTAGGTGGACCAATGAT No data
Right 1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG No data
1158346355_1158346363 2 Left 1158346355 18:56520656-56520678 CCCTATGCTAGGTGGACCAATGA No data
Right 1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158346363 Original CRISPR CTGAGGGAGAGGGATGTGGA AGG Intergenic
No off target data available for this crispr