ID: 1158354386

View in Genome Browser
Species Human (GRCh38)
Location 18:56600433-56600455
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 5, 1: 2, 2: 0, 3: 14, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158354386_1158354391 -10 Left 1158354386 18:56600433-56600455 CCTCCAACAGAATATTGAGACTG 0: 5
1: 2
2: 0
3: 14
4: 133
Right 1158354391 18:56600446-56600468 ATTGAGACTGGGGAACAATGTGG 0: 2
1: 5
2: 0
3: 12
4: 198
1158354386_1158354393 -8 Left 1158354386 18:56600433-56600455 CCTCCAACAGAATATTGAGACTG 0: 5
1: 2
2: 0
3: 14
4: 133
Right 1158354393 18:56600448-56600470 TGAGACTGGGGAACAATGTGGGG 0: 2
1: 5
2: 5
3: 27
4: 261
1158354386_1158354392 -9 Left 1158354386 18:56600433-56600455 CCTCCAACAGAATATTGAGACTG 0: 5
1: 2
2: 0
3: 14
4: 133
Right 1158354392 18:56600447-56600469 TTGAGACTGGGGAACAATGTGGG 0: 2
1: 5
2: 0
3: 11
4: 186
1158354386_1158354394 -4 Left 1158354386 18:56600433-56600455 CCTCCAACAGAATATTGAGACTG 0: 5
1: 2
2: 0
3: 14
4: 133
Right 1158354394 18:56600452-56600474 ACTGGGGAACAATGTGGGGCAGG 0: 2
1: 4
2: 3
3: 18
4: 264
1158354386_1158354395 19 Left 1158354386 18:56600433-56600455 CCTCCAACAGAATATTGAGACTG 0: 5
1: 2
2: 0
3: 14
4: 133
Right 1158354395 18:56600475-56600497 TTTCAACTCTAATTGTTACGTGG 0: 5
1: 2
2: 1
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158354386 Original CRISPR CAGTCTCAATATTCTGTTGG AGG (reversed) Exonic
910736190 1:90460446-90460468 CAGTTTTAATAATCTGATGGTGG - Intergenic
912803722 1:112739225-112739247 CAGTTTCAATATTCTGTATATGG - Intergenic
913209101 1:116569056-116569078 CAGTTCAAATAATCTGTTGGAGG + Intronic
915740562 1:158115618-158115640 CAGTCTCCATATTCTTCTTGTGG - Intergenic
918437312 1:184528999-184529021 CAATCTCCATATACTGCTGGTGG - Intronic
918745178 1:188189000-188189022 CACTCTCTATAATCTGTTGCAGG + Intergenic
919182073 1:194099651-194099673 AAAACTCAATATTCTGTTGATGG + Intergenic
923088485 1:230720360-230720382 CAGTGGTAATAATCTGTTGGAGG + Intergenic
1063217201 10:3935332-3935354 CACTCTCAAAACTCTGTCGGGGG - Intergenic
1066648591 10:37635009-37635031 CATTTTGCATATTCTGTTGGGGG + Intergenic
1068436461 10:56998132-56998154 CAGTCTCATTCTTCTGTATGTGG - Intergenic
1070545512 10:77449271-77449293 CAGTCTTTATTTTCTGTTGTTGG - Intronic
1072072377 10:91931623-91931645 CAGAGTCAGTATTATGTTGGAGG - Intronic
1073874466 10:107906272-107906294 CAGAATTAGTATTCTGTTGGAGG - Intergenic
1084926361 11:72515732-72515754 CAGTTTCAACCTTCTGTTTGTGG - Intergenic
1087183886 11:95165361-95165383 CTCACTCAATATTCTATTGGTGG - Intergenic
1087697821 11:101400925-101400947 CAGTTTCAATCTTCTGTATGTGG - Intergenic
1088728836 11:112663031-112663053 CAGTCTCAAAATTCTTCTAGTGG + Intergenic
1092623447 12:10299604-10299626 CAGTCCTAATTTTTTGTTGGTGG + Intergenic
1093394140 12:18660052-18660074 CAGTGTAATTGTTCTGTTGGAGG - Intergenic
1097657898 12:62391231-62391253 CAGTCTGAAGATTCAGTTGGAGG + Exonic
1097856543 12:64469470-64469492 CATTCTCATTTCTCTGTTGGTGG + Intronic
1101677761 12:106934594-106934616 AAGTCACAATATTTTGCTGGTGG - Intergenic
1103512233 12:121483310-121483332 CAGTCTCAAGATGCTAGTGGAGG + Intronic
1105469311 13:20678096-20678118 CAGTCTCAGTGTACTGTTAGAGG + Intronic
1108176574 13:47798606-47798628 CAGTCCTAATAATCTGTTTGAGG - Intergenic
1109359686 13:61280037-61280059 CAGTCTCAATTTTCTGTATTAGG - Intergenic
1111189019 13:84784238-84784260 CATCATCAATATACTGTTGGAGG + Intergenic
1111807541 13:93056207-93056229 CAGATTCAAGATCCTGTTGGAGG + Intergenic
1112410383 13:99157832-99157854 CAGTCTCATTTATCTGTTGATGG + Intergenic
1116039052 14:39663471-39663493 CAGTTTCAAAATTCTCCTGGTGG - Intergenic
1117057137 14:51924091-51924113 CAATCTCAATATGATGTTAGTGG - Intronic
1118131095 14:62964530-62964552 CAGAGTTAATATTCTGGTGGGGG - Intronic
1125235730 15:37511395-37511417 CCGCCTCAATATTCTGTGTGTGG + Intergenic
1126028633 15:44474116-44474138 GAGTCTTAACATTCTGTGGGTGG - Intronic
1130761585 15:86826350-86826372 CATTCTCAATATTCTTCAGGTGG - Intronic
1134404509 16:13944377-13944399 CAGTCTCAAGAATCTCTTGGTGG + Intronic
1139070869 16:63380980-63381002 CAGTGTCAATATGCTAGTGGTGG + Intergenic
1139378904 16:66517937-66517959 CCGTCTCAAGATCCTTTTGGGGG - Intronic
1143924549 17:10358086-10358108 CAGTCTGGATGTTCTGATGGAGG - Intronic
1146102682 17:30000019-30000041 CAGTTTCAATTGTCTGTTGGTGG + Intronic
1149401787 17:56304061-56304083 CAATATCAATATTCTGGTTGTGG - Intronic
1149798425 17:59543251-59543273 GGGTCTCAATAATCTGTTGGAGG - Intergenic
1150734136 17:67721479-67721501 CAGTTTCAATTTTCTGCTGGGGG - Exonic
1150745463 17:67813196-67813218 CAGTCTAAATATTCTCTTGATGG + Intergenic
1151858419 17:76739060-76739082 CAATCACAATATTCTATTGCTGG - Intronic
1153156838 18:2159470-2159492 CAGTCTTATAATTCTGTGGGAGG - Intergenic
1157055130 18:44218890-44218912 CAGTTTCAATATTCTGTATATGG - Intergenic
1158194886 18:54873604-54873626 TAGCCTCAATATTCTATTGTTGG - Intronic
1158354366 18:56600297-56600319 CAGTCTCAATATTCTGTTGGAGG - Exonic
1158354376 18:56600365-56600387 CAGTCTCAATATTCTGTTGGAGG - Exonic
1158354386 18:56600433-56600455 CAGTCTCAATATTCTGTTGGAGG - Exonic
1158354396 18:56600501-56600523 CAGTCTCAATATTCTGTTGGAGG - Exonic
1158354406 18:56600569-56600591 CAGTCTCAATATACTGTTGGAGG - Exonic
1158354416 18:56600637-56600659 CAGTCTCAATATACTGTTGGAGG - Exonic
1158354426 18:56600705-56600727 CAGTCTCAATATTCTGTTGGAGG - Exonic
1159792695 18:72802880-72802902 CAGTTTTAATATTCTGTAAGAGG + Intronic
1165148661 19:33748587-33748609 CTGTCTCAACATGGTGTTGGGGG + Intronic
1167841049 19:52120499-52120521 CAGTCTCTATCTTCTGATTGTGG - Intronic
1168226753 19:55000823-55000845 CAGTATCAATAATCAGTTGTGGG - Exonic
925572103 2:5323519-5323541 CAGTAGCAAGATTTTGTTGGAGG + Intergenic
925957797 2:8985393-8985415 AGGTCTCAATATTCTATTTGGGG - Intronic
930327181 2:49934510-49934532 CTGTCTCAATTTTCTTTTGTTGG + Intronic
935575213 2:104702072-104702094 CAGTCACATTATGCTGCTGGTGG - Intergenic
936747728 2:115599771-115599793 CACCTTCAATAATCTGTTGGAGG - Intronic
936995386 2:118408909-118408931 CTGTCACAACATTCTGTTGCTGG + Intergenic
937164804 2:119802835-119802857 GTGTTTGAATATTCTGTTGGGGG + Intronic
939117879 2:138081416-138081438 CAGTGTCAATATTCTGATTGTGG - Intergenic
940613218 2:156016962-156016984 CTGGCTTAATATTCTGTTAGGGG - Intergenic
941894434 2:170614959-170614981 CAGTTTCAAGACTGTGTTGGAGG - Intronic
943307376 2:186280365-186280387 CAGTTTCAATCTTCTGTTTATGG + Intergenic
945957177 2:216097338-216097360 CAGTCTCAAACTCCTGTTGTTGG - Intronic
945976711 2:216276834-216276856 CAGCCACAATCATCTGTTGGGGG + Intronic
1175300055 20:57936432-57936454 CAATGTCAATATTCTGGTTGTGG - Intergenic
1182212013 22:28684553-28684575 CACTCTTAATTTTCTCTTGGAGG - Intergenic
1184611991 22:45610110-45610132 CATTCCCAATATTCTGGAGGGGG + Intergenic
1185059057 22:48596417-48596439 CATTCTCAATATTCTGTCAAGGG + Intronic
949665827 3:6338328-6338350 AAGTCTCAACTTTCTCTTGGGGG - Intergenic
949847335 3:8385044-8385066 CAGTCTTAATGGTCTGTGGGAGG + Intergenic
951859408 3:27235058-27235080 CAGTTTCAATTTTCTGCTTGTGG - Intronic
963195997 3:142531090-142531112 CTGTCTCAAAGTTCTGTTGAAGG + Intronic
964350395 3:155797566-155797588 CAGTTCCAATAGTCTTTTGGTGG - Intronic
964903415 3:161689136-161689158 CAGTATAAATATTTTGTTGCAGG - Intergenic
966673184 3:182552513-182552535 CAGTTTCAATTTTCTGCTTGTGG + Intergenic
966817676 3:183902583-183902605 CATTCACAATATTCTTTTGTGGG - Intergenic
967753872 3:193146458-193146480 CAATGTCAGTATTCTCTTGGTGG - Intergenic
968540068 4:1163334-1163356 CAGTTTCAATATACTGTGTGTGG + Intergenic
969343168 4:6555211-6555233 CACCCTCAATACTCTGTTGGTGG + Intronic
970228489 4:13884351-13884373 CAGTTTCAATTTTTTTTTGGAGG + Intergenic
970372402 4:15421293-15421315 CACTCTCAACATTCTGTGGCTGG + Intronic
971114190 4:23624641-23624663 CAGTTTCAAGAGTCTTTTGGTGG - Intergenic
971231977 4:24807433-24807455 CAGCCTCAACATTCTGTTGAAGG + Exonic
974239824 4:59232464-59232486 AAGTCTGATTATTCTGTTGATGG + Intergenic
977256348 4:94744770-94744792 TAATCTCAATATTATGTTTGTGG - Intergenic
977902989 4:102443793-102443815 CAGTCTAAATATTTAGTAGGAGG - Intergenic
980095516 4:128486254-128486276 CAGTTTCAATCTTCTGTATGTGG - Intergenic
980239219 4:130151776-130151798 AAATCTCAGTATACTGTTGGTGG + Intergenic
980333153 4:131435726-131435748 CAGTTTCAATCTTCTGTTTATGG + Intergenic
981320209 4:143383257-143383279 AAGTCTCAATGATCTGATGGTGG - Intronic
983015954 4:162612726-162612748 CAGTTTCAATCTTCTGTGTGTGG - Intergenic
983828435 4:172295438-172295460 CAGTCTCAATTTTCTGATTGTGG - Intronic
984332688 4:178345800-178345822 GAGTCTCAAAATTTTGTTGTAGG + Intergenic
987355756 5:17061979-17062001 CAGTCCCATGATTCTGTGGGAGG - Intergenic
987833997 5:23137224-23137246 CTGTCTTAATTTTCTGTTGGTGG - Intergenic
989288166 5:39728425-39728447 CAGTTTCAATCTTCTGTAAGTGG + Intergenic
991594626 5:68289570-68289592 CATTCACAATATTATGATGGCGG - Intronic
992172671 5:74119866-74119888 CTGTCTCAATATTAAGTTTGTGG + Intergenic
992271662 5:75070576-75070598 TAGTCTCATAATACTGTTGGTGG - Intronic
993800280 5:92324825-92324847 CACTCTCAAGATTCTGTTATAGG + Intergenic
994384384 5:99112383-99112405 AAGTATGAATATTCTCTTGGAGG + Intergenic
994546217 5:101169741-101169763 CAGTTTCAATATTCTGCTTATGG + Intergenic
995379327 5:111514162-111514184 CAGTCTATATATTCTCTTGCAGG + Intergenic
997709817 5:135994853-135994875 CAGTCTGAGTACTGTGTTGGGGG + Intergenic
997775828 5:136603576-136603598 CAGTTTCATTATTCTGTATGTGG + Intergenic
998284587 5:140846985-140847007 CATTCTCAATATTCTCCCGGGGG - Intronic
999851367 5:155543066-155543088 AACTCTCAAAATTCTGCTGGTGG - Intergenic
1003563744 6:7204939-7204961 CATTCTTAAAATTCTTTTGGGGG - Intronic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1012092874 6:94920953-94920975 CAGGCTGAATCTTTTGTTGGGGG + Intergenic
1012266036 6:97144158-97144180 TTGTCTCAACATTCTGTTAGTGG - Exonic
1012706836 6:102542051-102542073 CAGTTTCAATATTCTGCTTATGG - Intergenic
1017217171 6:151922256-151922278 CAGTTTCAATTTTCTGTATGTGG - Intronic
1020534786 7:9383106-9383128 CAGTATCATTATTCTGTGTGTGG + Intergenic
1020689245 7:11334252-11334274 CAGTTTCAATATTCTGCTTATGG + Intergenic
1020963417 7:14834978-14835000 CAGACACAATTTCCTGTTGGTGG - Intronic
1021877316 7:25060699-25060721 CAGTCTCACCATTCTCCTGGTGG - Intergenic
1028719222 7:94010632-94010654 CAGGGTAAATATTCTGTGGGTGG - Intergenic
1034920117 7:155072632-155072654 CAGTCCCCATTTTCTGTTGTTGG + Intronic
1040404057 8:47082605-47082627 CAGTATCACTATTCAGTAGGGGG + Intergenic
1041868315 8:62602701-62602723 CAGTCTTAAGATTATGCTGGAGG + Intronic
1043001477 8:74765188-74765210 CAGTTTCAATATTCTGTATATGG - Intronic
1043223427 8:77694915-77694937 CAGTCTCATTATTCTGCTTATGG + Intergenic
1044388180 8:91615334-91615356 CAGTCTCAGTAGACTGCTGGGGG + Intergenic
1044999788 8:97869354-97869376 CAGGCTCGGTATTCTGTCGGTGG - Intronic
1046521596 8:115332590-115332612 CAGTCTCAATGTTGTGTTTGGGG + Intergenic
1047386523 8:124415256-124415278 CAGTCTCACCATCCTGTTTGGGG - Intergenic
1057088142 9:92229752-92229774 CAGTGTCAATATGCTGGTTGTGG - Intronic
1058167003 9:101631596-101631618 CAGGCTCAGAATTCTGCTGGAGG + Intronic
1058218713 9:102268449-102268471 CAGTTTGAATATTTTTTTGGTGG + Intergenic
1186194884 X:7100059-7100081 CAGCCTGATTATGCTGTTGGTGG - Intronic
1187486491 X:19709079-19709101 CAGTCTCATTATTCTGTTTCAGG - Intronic
1189861563 X:45277202-45277224 CAGTCTCAATATTCTACTTGTGG + Intergenic
1191092895 X:56642409-56642431 CAGCCTCAATCTTCTGCAGGTGG + Intergenic
1192292629 X:69814241-69814263 TAGTCTGAATATTTTGTTTGAGG - Intronic
1192502018 X:71660670-71660692 CAGCCTCAGTATTGTGTGGGAGG + Intergenic
1192752331 X:74006192-74006214 AAGTCCCAACATTCTGTTAGTGG + Intergenic
1193716797 X:84943420-84943442 CAGTCCTATTATTCTGTGGGAGG + Intergenic
1193872174 X:86813300-86813322 CAGAGTGAATATTATGTTGGGGG + Intronic
1193882080 X:86935987-86936009 CAGTAACAATATTCTGATGCGGG + Intergenic
1194353106 X:92846136-92846158 AAGTGTCCATATTCTGATGGTGG + Intergenic
1199156766 X:144558336-144558358 CAGTTTCAATATTCTGCTTATGG - Intergenic
1199667802 X:150114790-150114812 CAGCTTCAATTTTCTGCTGGGGG - Intergenic
1199707881 X:150446584-150446606 CATTCTCAATACATTGTTGGTGG - Intronic
1200661462 Y:5963232-5963254 AAGTGTCCATATTCTGATGGTGG + Intergenic