ID: 1158355259

View in Genome Browser
Species Human (GRCh38)
Location 18:56611558-56611580
Sequence AGGATAGGACTACTAATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158355259 Original CRISPR AGGATAGGACTACTAATTAT AGG Intronic
903383229 1:22910690-22910712 AGGACAGGACTAGTGTTTATTGG + Intronic
904231896 1:29081089-29081111 AGCAAAAGACAACTAATTATTGG - Intronic
905421075 1:37844864-37844886 AGAATAGGCATCCTAATTATAGG + Intronic
912057123 1:105616255-105616277 AGGATAGAAAAACTAACTATAGG + Intergenic
915096067 1:153463459-153463481 AGGATAGGACTATTATTGCTGGG - Intergenic
916440814 1:164822788-164822810 AGGATAGGACTACTAAGTAGTGG + Intronic
921279283 1:213549781-213549803 AGGATAGCAATACTATTTCTGGG + Intergenic
1063715270 10:8520642-8520664 AGGATAGGAACACTATTTAATGG + Intergenic
1064843251 10:19620284-19620306 AGGATAAAACTACTACCTATTGG - Intronic
1068815023 10:61299757-61299779 AGAATAAGACTATTATTTATTGG + Intergenic
1078658835 11:13268151-13268173 AGGATAGTCCTACTAATAAAAGG - Intergenic
1078926551 11:15880532-15880554 AGGATAAGCCTAGCAATTATTGG - Intergenic
1081264852 11:41007911-41007933 TGGATAGTGCTGCTAATTATTGG - Intronic
1085899625 11:80683490-80683512 AGAAAAAGACTACTAATAATGGG - Intergenic
1086323950 11:85679664-85679686 AGGAGAGAAATACTAATCATTGG + Intronic
1094269918 12:28602065-28602087 AGGATGGGATTGCAAATTATAGG - Intergenic
1103119511 12:118369855-118369877 AGGAGAGGACTTCTAGTTAGCGG + Intronic
1107251490 13:38368811-38368833 AGGAAGGATCTACTAATTATAGG - Intergenic
1107879509 13:44820819-44820841 AGGATTGGACTATTCATTGTAGG + Intergenic
1109182387 13:59229520-59229542 AGGATGGAACTAATAATTATGGG - Intergenic
1110517396 13:76430832-76430854 AGAATAGAAATCCTAATTATAGG + Intergenic
1129414455 15:75367659-75367681 AGGATAGGACTTCTACCTCTAGG - Intronic
1139067920 16:63342095-63342117 AGGACAGCACTACAAATTAATGG - Intergenic
1144353353 17:14420758-14420780 AAGATAGGTCTAATAAGTATTGG - Intergenic
1150912019 17:69398300-69398322 AGTATGGTACTACTAATTTTAGG - Intergenic
1155282966 18:24259493-24259515 AGGATAGTAGAACTAATTAAAGG + Intronic
1158355259 18:56611558-56611580 AGGATAGGACTACTAATTATAGG + Intronic
933316096 2:80717160-80717182 AAAATAGGATTACTAATTATTGG + Intergenic
942822972 2:180138255-180138277 AGGATAGGACCACATTTTATAGG + Intergenic
948585035 2:239014090-239014112 GGGATAGTAATACAAATTATGGG + Intergenic
1174991242 20:55512754-55512776 AAAATAGGACTCCTGATTATAGG + Intergenic
1176876974 21:14140104-14140126 ATTATAGGACAACAAATTATAGG + Intronic
1176959294 21:15141332-15141354 ATAATGGGAATACTAATTATCGG - Intergenic
950989859 3:17421945-17421967 AGGAAAGGAGCACTAATTCTAGG + Intronic
956122840 3:65983304-65983326 AGGAGAGCACTACTAAACATTGG - Intronic
958087068 3:88823945-88823967 TGGATAAGGCTACTAATTATAGG + Intergenic
959753131 3:109862327-109862349 AGGATTGAACAACTAACTATTGG + Intergenic
959754299 3:109878406-109878428 AGGTCTGGAATACTAATTATTGG + Intergenic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
963112436 3:141698573-141698595 AGGGTTGGAGTATTAATTATGGG + Intergenic
964511270 3:157454724-157454746 AGGATAGAAAAACTACTTATTGG - Intronic
971086191 4:23278226-23278248 AGGATAGAAGAACTACTTATTGG + Intergenic
971114666 4:23630833-23630855 ATGATAGGACTACAGATCATTGG + Intergenic
972093031 4:35312321-35312343 ATTATAGGACTAATAATTTTGGG - Intergenic
975182079 4:71357948-71357970 AGGAAAGAACTACTAAGCATTGG + Intronic
981445718 4:144836161-144836183 AGGGTAGGAATATAAATTATTGG - Intergenic
988008244 5:25448405-25448427 AGGATAGCATTTCTAATTCTGGG + Intergenic
988433613 5:31148411-31148433 AGGATTGTAATACTAATAATCGG - Intergenic
989794661 5:45452524-45452546 AGGATAGGAAAACTACCTATTGG - Intronic
990757281 5:59087572-59087594 AGGACAGGACTATTAATCTTAGG - Intronic
998420871 5:141985165-141985187 AGGATAGGACTATGAATAGTAGG + Intronic
999056061 5:148578128-148578150 ATGATAAGACTACAAATTCTGGG + Intronic
1007898171 6:45384146-45384168 AGGATAGGAATACTTAATGTAGG + Intronic
1009678258 6:66856127-66856149 AGGACAGGTTTGCTAATTATAGG + Intergenic
1010886355 6:81247005-81247027 AGGATTGGAAAATTAATTATTGG + Intergenic
1014907919 6:127052653-127052675 AGGGTTGGAAAACTAATTATTGG + Intergenic
1015619367 6:135114344-135114366 AGTATAGATCTACTAAATATAGG + Intergenic
1017399847 6:154047514-154047536 AGGATAGGACTAATACCTAAAGG - Intronic
1028992773 7:97067231-97067253 AGGATAGGACTAGGGATAATGGG + Intergenic
1031218980 7:118939225-118939247 AGGATACGACTACTAACAATAGG + Intergenic
1031380768 7:121083363-121083385 AAGCTAGGACAACTAATTCTTGG - Intronic
1031432765 7:121693137-121693159 AGGATAGAAAAACTAACTATTGG + Intergenic
1033430245 7:141282444-141282466 AGGAAAGCCCTACTGATTATAGG - Intronic
1037920866 8:22804541-22804563 AGTATGGTACTACTAAGTATAGG + Intronic
1038059320 8:23894977-23894999 AGGATAGGAATAATAACTATGGG - Intergenic
1041551865 8:59111807-59111829 TGGAAAGGACTCCTAATTAAAGG - Intronic
1044689830 8:94866238-94866260 AGAATATGACTAAAAATTATTGG + Intronic
1047459484 8:125048649-125048671 AGCATAGAACTACCCATTATAGG + Intronic
1047631372 8:126712308-126712330 AGGATAGGACAATGAATTTTGGG - Intergenic
1048520357 8:135148208-135148230 AGGAAAGGACTCCTATTTCTTGG - Intergenic
1052390034 9:27869121-27869143 AGGATTGAACTACTAATTTGAGG + Intergenic
1052668415 9:31523678-31523700 GGGGTAAGACTACTAATTTTAGG + Intergenic
1054739916 9:68794794-68794816 AGGAGAGGACCAGTAATGATAGG + Intronic
1061691117 9:132331805-132331827 AGGATGGGACTACAAAGTTTTGG - Intronic
1186666942 X:11726763-11726785 AGGATCGAACTAGTAATTAATGG + Intergenic
1186707682 X:12159337-12159359 AGGCTAGGAATTGTAATTATGGG + Intronic
1188637998 X:32459808-32459830 AGGATAGGAATAATACTTCTGGG + Intronic
1190892068 X:54578446-54578468 AGGATAGCACAAGGAATTATTGG - Intergenic
1191146949 X:57177132-57177154 AGGATGGGACTTCTCACTATTGG - Intergenic
1192742145 X:73903912-73903934 AGGATTGGACTCCTGATCATAGG + Intergenic
1193201897 X:78701329-78701351 AGGATAGGGCTGCTATGTATAGG + Intergenic
1193428872 X:81375412-81375434 TGGAAAGAACAACTAATTATAGG + Intergenic
1193597984 X:83471644-83471666 AGCTTAGGACTACTATTTCTTGG - Intergenic
1195068823 X:101260639-101260661 AGGAGAGGACTATGAACTATAGG - Exonic
1195324146 X:103744339-103744361 AGGGAAGGACTGCTTATTATGGG + Intergenic
1195628861 X:107032972-107032994 GGGATGGGACTAGTAATTTTTGG - Intergenic
1196871622 X:120117800-120117822 AGGAAAGGACTACCAGTAATGGG + Intergenic
1201649885 Y:16273824-16273846 AGGCTATGACTACTACTTGTCGG - Intergenic