ID: 1158362052

View in Genome Browser
Species Human (GRCh38)
Location 18:56685975-56685997
Sequence CTCGGTGACTGGCATCCTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158362048_1158362052 10 Left 1158362048 18:56685942-56685964 CCTTCTCATTTTAGAGGACACAG 0: 1
1: 0
2: 0
3: 21
4: 212
Right 1158362052 18:56685975-56685997 CTCGGTGACTGGCATCCTGAAGG 0: 1
1: 0
2: 1
3: 11
4: 118
1158362047_1158362052 11 Left 1158362047 18:56685941-56685963 CCCTTCTCATTTTAGAGGACACA 0: 1
1: 0
2: 0
3: 29
4: 277
Right 1158362052 18:56685975-56685997 CTCGGTGACTGGCATCCTGAAGG 0: 1
1: 0
2: 1
3: 11
4: 118
1158362045_1158362052 29 Left 1158362045 18:56685923-56685945 CCTGGGCTGCTTTTTTGTCCCTT 0: 1
1: 0
2: 2
3: 21
4: 383
Right 1158362052 18:56685975-56685997 CTCGGTGACTGGCATCCTGAAGG 0: 1
1: 0
2: 1
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158362052 Original CRISPR CTCGGTGACTGGCATCCTGA AGG Exonic