ID: 1158364613

View in Genome Browser
Species Human (GRCh38)
Location 18:56719266-56719288
Sequence AAAAAACAGAATTGCTGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2051
Summary {0: 1, 1: 2, 2: 35, 3: 270, 4: 1743}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158364613 Original CRISPR AAAAAACAGAATTGCTGGCC GGG Intronic
Too many off-targets to display for this crispr