ID: 1158367696

View in Genome Browser
Species Human (GRCh38)
Location 18:56757172-56757194
Sequence ATGGGAAAACAGAAGTAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 624}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158367692_1158367696 -4 Left 1158367692 18:56757153-56757175 CCTGCTTGTAAACTGTCACATGG 0: 1
1: 0
2: 2
3: 10
4: 110
Right 1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG 0: 1
1: 0
2: 4
3: 69
4: 624
1158367691_1158367696 11 Left 1158367691 18:56757138-56757160 CCGGGTTATAATCAGCCTGCTTG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG 0: 1
1: 0
2: 4
3: 69
4: 624
1158367688_1158367696 30 Left 1158367688 18:56757119-56757141 CCATATGTCACTGATGCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG 0: 1
1: 0
2: 4
3: 69
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158367696 Original CRISPR ATGGGAAAACAGAAGTAGGA AGG Exonic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
901101284 1:6721025-6721047 CTGGGAAAACAGAACTAAGGTGG - Intergenic
901154335 1:7125377-7125399 ATGGGGAGACAGAAGTAGATAGG + Intronic
901905314 1:12404381-12404403 TTAGGAAGAGAGAAGTAGGAAGG - Intronic
902159142 1:14515546-14515568 ATGGTAGAACAGGAGAAGGATGG - Intergenic
902208448 1:14887134-14887156 ATGGGAAAACAGAGGAGGAAAGG - Intronic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
903530378 1:24025748-24025770 AGAGGCAAACAGAAGAAGGATGG - Intergenic
903614101 1:24639657-24639679 ATGGGAAACCAGAAGGTTGAAGG + Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904435454 1:30492016-30492038 ATGGGTGAACAGAAGTGGGTGGG + Intergenic
904823787 1:33261777-33261799 TTGGGGAAACTGAAGTGGGAAGG + Intronic
904937739 1:34143686-34143708 ATGGGAGAAAAAAAGAAGGAAGG + Intronic
905097510 1:35486540-35486562 ATGGGAAAATAGAAACAAGAGGG - Intronic
905392966 1:37650063-37650085 ATAGGAAAACTGAAGGAGGCTGG + Intergenic
905525856 1:38639009-38639031 ATGGGAGAAGAGAGGTAAGAGGG - Intergenic
905543410 1:38778411-38778433 GTGGGAGAACAGAGGTAGGTAGG - Intergenic
906029337 1:42705264-42705286 ATGGGAAAACAAATGTACTAGGG + Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906626765 1:47332009-47332031 ATGGGAAAAGAAGGGTAGGAAGG + Intergenic
907165087 1:52403667-52403689 GTTAGAAAAGAGAAGTAGGAAGG + Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908923197 1:69221359-69221381 ATGGGAAAAAAGAAATAGGGAGG + Intergenic
908954019 1:69599176-69599198 CTAGGATCACAGAAGTAGGATGG + Intronic
909228350 1:73054838-73054860 ATGAGAAAACAGAATTAAGCAGG - Intergenic
909319386 1:74264064-74264086 ATGAGAAAATAGAAGAAGGAGGG + Intronic
910190583 1:84590921-84590943 AATGGAAAACAGAAGAAGCAGGG + Intergenic
910298853 1:85682889-85682911 GTGGGCAAACAGAAGTTGAAGGG + Intronic
910417917 1:87020998-87021020 ATGGGAAAAGAGGAGTAGCTGGG - Intronic
911719943 1:101180021-101180043 ATGGGAATTCAGGAGTAGCATGG + Intergenic
911884216 1:103277259-103277281 ATGGGAAAATAGAAGTTCAAAGG + Intergenic
911965893 1:104371176-104371198 AAGGAAGAAAAGAAGTAGGAAGG - Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912157375 1:106938434-106938456 ATGGGAAAAGAGAAGGATGCTGG - Intergenic
912925336 1:113907814-113907836 ATTGAAAAATAGGAGTAGGATGG + Intronic
914213016 1:145598967-145598989 ATGAGAAAAGAGAATTTGGAAGG + Intergenic
914464953 1:147919306-147919328 ATGAGAAAAGAGAATTTGGAAGG + Intergenic
914713875 1:150238222-150238244 AGGGGAAAAGAGAAGAGGGAGGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916389409 1:164314738-164314760 AAGCGAAAACAGAGGTAGCAGGG + Intergenic
916476435 1:165173818-165173840 ATTGGAAAACAGAAATAGGGAGG + Intergenic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
916815361 1:168346521-168346543 ATAGGTACACAGAAGTGGGATGG - Intergenic
916920547 1:169461513-169461535 ATTGGAAAAGATAAGTAGAAAGG - Intergenic
917039494 1:170788631-170788653 AGGGGATAAAAGAAGTAGGAAGG + Intergenic
917177005 1:172246430-172246452 ATGGGAAAAGACAAGAAGGCTGG + Intronic
918003983 1:180524739-180524761 ATGTGGAATCAGAAGTAGGGAGG + Intergenic
918162370 1:181913290-181913312 TTGGGAAAACAGAAGTATCCAGG + Intergenic
918746024 1:188200852-188200874 TAAGGAACACAGAAGTAGGAAGG - Intergenic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919463613 1:197907525-197907547 ATGAGAAAACAGTAGGAGAACGG - Intergenic
920015143 1:202901110-202901132 GTGGGAGAAAAGAAGTAGAAAGG + Intronic
920221631 1:204407779-204407801 ATAAGAAAACAGAGGTAGAAGGG + Intronic
920393689 1:205628293-205628315 GTGGGAAAACTGTAGTAGAACGG - Intronic
920740053 1:208572639-208572661 ATGGGAAAACATAAAAAGGTAGG - Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920916751 1:210263869-210263891 GTGGTAAAGCAGGAGTAGGAAGG + Intergenic
921045424 1:211473455-211473477 ATGGAAAAAAAGAAGGAGAAGGG + Intergenic
922942287 1:229477771-229477793 ATTGGAAAACACAAGTATTAAGG + Intronic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923268504 1:232334698-232334720 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
923937868 1:238784351-238784373 AGAGGGAAACAGAAGTTGGAAGG + Intergenic
924111665 1:240705671-240705693 ATGGCAAAAGAAAAGAAGGAAGG + Intergenic
924557752 1:245132125-245132147 AAGGCAAAACAGAGGTGGGAGGG + Intergenic
924648167 1:245899430-245899452 ATGGGAAAACAGGAGCGGGGAGG + Intronic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1063865457 10:10360447-10360469 ATGTGAAAAAAGAGGAAGGAAGG + Intergenic
1064205378 10:13319593-13319615 CTGGGAAAGCTGAAGTGGGAGGG - Intronic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065423058 10:25568423-25568445 GTAGGAAGAGAGAAGTAGGAAGG + Intronic
1067373431 10:45705717-45705739 TTGAGAAAACAGAAGCAGAAAGG + Intergenic
1067380262 10:45766497-45766519 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067691413 10:48504480-48504502 ATGGGATAACAGAAATGGGGTGG + Intronic
1067887963 10:50107151-50107173 TTGAGAAAACAGAAGCAGAAAGG - Intronic
1067894148 10:50161604-50161626 AGTGAAAAACAGAAGTAGGATGG - Intergenic
1067954697 10:50778657-50778679 AGTGAAAAACAGAAGTAGGATGG + Intronic
1068162780 10:53287982-53288004 ATGGGACAATAGAAGTAAGCTGG + Intergenic
1068170622 10:53388909-53388931 AAGGGAAAGCGCAAGTAGGAAGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068813623 10:61284905-61284927 AATGGAAAACATGAGTAGGATGG - Intergenic
1069043194 10:63716111-63716133 TTGAGAAAACAAAAGCAGGAAGG + Intergenic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1070284959 10:75076162-75076184 CTGGGAAAAGAATAGTAGGATGG + Intergenic
1070458042 10:76637105-76637127 ATAAGAGAAAAGAAGTAGGAAGG - Intergenic
1070992408 10:80744122-80744144 ATTGAAAAAGAGAAGTAGGCTGG + Intergenic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071684773 10:87743345-87743367 AGAGGAAAGCAGAAGAAGGAAGG - Intronic
1071967671 10:90868713-90868735 AGAGGAAAGGAGAAGTAGGAAGG - Intergenic
1072415899 10:95246641-95246663 ATGAGAAAACAGACCTGGGAAGG + Intronic
1073078501 10:100839905-100839927 AGGGGAAAAGAAAAGAAGGAAGG + Intergenic
1074217229 10:111397612-111397634 AGGGGAAAGGAAAAGTAGGAGGG + Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1075166335 10:120071288-120071310 ATGGGAACACAGCACCAGGAGGG + Intergenic
1075650182 10:124122784-124122806 ATGGAAAATCACAACTAGGATGG - Intergenic
1075969661 10:126641776-126641798 AGGAGAAAACAAATGTAGGAAGG - Intronic
1076961940 10:133770257-133770279 ATGGGAAAATTTAAGTAGGTGGG + Intergenic
1077857447 11:6143198-6143220 ATGGGACTACATAACTAGGATGG - Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078319880 11:10324850-10324872 GTGGGAAACCCGAAGCAGGAAGG + Intronic
1078360256 11:10662468-10662490 ATGGCAGAACAGAAGCATGAAGG - Intronic
1078405264 11:11065321-11065343 ATGAGGATACAAAAGTAGGAGGG - Intergenic
1078671707 11:13371514-13371536 AGTAGAAAACAGAAGTAGGAAGG - Intronic
1079277972 11:19059332-19059354 ATGGGGAAATAGAAATTGGAAGG + Intronic
1079645149 11:22853648-22853670 ATTGGAAAAAAAAAGAAGGAAGG + Intronic
1080549735 11:33362275-33362297 ATCAGGAAACACAAGTAGGATGG + Intergenic
1080904295 11:36525037-36525059 AAGGGAAAAAAGAACAAGGAAGG - Intronic
1081307841 11:41535254-41535276 ATGAGAAAACAGAACTCGGGGGG - Intergenic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1082645791 11:55723077-55723099 ATGGCGAAACACAAGTAGAAAGG + Intergenic
1082825442 11:57574355-57574377 ATGGGAAAACCAAGGTAGGGAGG - Intergenic
1082909488 11:58354126-58354148 CTGGGAAAAAAGAAATGGGAAGG - Intergenic
1083115623 11:60456576-60456598 ATGGGAAACCAAGAGTAAGAGGG + Intronic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083484253 11:62973501-62973523 ATGAGACAACAGAAGCAAGAGGG - Intronic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1084457226 11:69274891-69274913 ATGGGAAAGCAGCATTAGGGAGG + Intergenic
1084559029 11:69892405-69892427 ATGGGAAAACTGAGGCATGAGGG - Intergenic
1084903644 11:72329178-72329200 TTGGGAAAACAGAATTAGAATGG + Intronic
1084953557 11:72679644-72679666 ATGGGAAAACTGAGGTCAGAGGG + Intergenic
1087622215 11:100555152-100555174 TTGAGAAAACAGCAGAAGGAAGG + Intergenic
1087968395 11:104448712-104448734 AGGGGAGAACAGGAGTAGGCAGG + Intergenic
1088414057 11:109569431-109569453 ATGGGACAAAAGAATTTGGATGG - Intergenic
1089014707 11:115156574-115156596 AGGGGAAGACAGAAGGAGGGAGG - Intergenic
1089309626 11:117549105-117549127 ATGGGGAAACACATGTAGGAAGG - Intronic
1089843215 11:121436907-121436929 ATGATAAAACAAAAGTAGGGAGG + Intergenic
1090020799 11:123126599-123126621 ATAAGAAAACAGAACTAGGCTGG + Intronic
1090511060 11:127376067-127376089 ATGGGTACTAAGAAGTAGGAGGG - Intergenic
1091081578 11:132673949-132673971 AGGGTAGTACAGAAGTAGGAAGG - Intronic
1091240261 11:134047328-134047350 GTGGGATAACAAAAGGAGGATGG + Intergenic
1091458903 12:629256-629278 GTGGGAAAACTGAAGCCGGAAGG + Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092233591 12:6791898-6791920 GTGGGGAATCAGAAGTAGGTGGG + Intronic
1092511609 12:9162755-9162777 TTGGGAAAAAAAGAGTAGGATGG - Intronic
1092878699 12:12870998-12871020 ATGAGAAAACAGAAGTGGAAAGG - Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093075864 12:14758127-14758149 ATAGAAAAACACAAGAAGGAAGG + Intergenic
1093521624 12:20057764-20057786 ATAGGAAAGAAGAAGAAGGAAGG - Intergenic
1093534013 12:20201876-20201898 ATGGGACAAAAGAATTTGGATGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094020693 12:25910890-25910912 ATGGAAAATAAGCAGTAGGAAGG - Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095166860 12:38983234-38983256 CTAGGGTAACAGAAGTAGGAAGG - Intergenic
1095267116 12:40173566-40173588 AGGTGAAAACAGAATTAGAAAGG + Intergenic
1095389681 12:41690522-41690544 ATGGGTAAACATAAGCAGAAAGG + Intergenic
1097249200 12:57623124-57623146 GTGGGAAAACACAGGTAAGAGGG + Exonic
1097536288 12:60873898-60873920 ACGCGGAAAGAGAAGTAGGATGG - Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098986926 12:77022624-77022646 AAGGAAGAAAAGAAGTAGGAAGG + Exonic
1099536205 12:83848179-83848201 AGGAGAAGACAGAAGTAGGGAGG - Intergenic
1099599448 12:84714157-84714179 ATGGGCAAAGAGTAGAAGGATGG + Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100797060 12:98193438-98193460 AAGCCAAAACAGAATTAGGAAGG - Intergenic
1101205642 12:102484324-102484346 TAGGGAAAACAGAAATAGGGAGG + Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102698120 12:114815677-114815699 ATGGAAAAACAGAGCTAAGAAGG - Intergenic
1103426950 12:120844276-120844298 ACGGGGAAACAGAAGTGGAAGGG - Intronic
1104092801 12:125529683-125529705 TTGGGAAGCCATAAGTAGGAGGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1105485791 13:20830305-20830327 ATTGGAAAACAAAAGTAACATGG - Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1106774911 13:32999475-32999497 ATTGGAAAACAGAGGTTGGGCGG - Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107130525 13:36889467-36889489 ATGAGAAAACAGAAGCAAAATGG + Intronic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107326984 13:39254886-39254908 ATGAAAAAACAGCAGTAAGAGGG - Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108305422 13:49127325-49127347 AGGGGAATACAGAAATAGGGTGG - Intronic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1110313131 13:74074121-74074143 ATGAGAAAACAGTAGCAGAAGGG - Intronic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1112402795 13:99090014-99090036 ATGTGACAACAAAGGTAGGAAGG + Intergenic
1113145911 13:107207196-107207218 AAGGGAAAAAAGAAATGGGAAGG - Intronic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1114557145 14:23568515-23568537 ATGGGAAAACAACAGAAGGAGGG - Exonic
1115362043 14:32514791-32514813 CTGGGAAAGGATAAGTAGGAGGG + Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115884611 14:37957652-37957674 ATAGCAAAAGAGAAGTAGAATGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117313162 14:54548526-54548548 AGGGGAAAACAGAGGTAACAAGG - Intergenic
1117406594 14:55410139-55410161 ATGGGAAAACAGATTTATGATGG + Intronic
1117866996 14:60160431-60160453 AAGGGAAAATAGAAATAGGATGG + Intronic
1118147410 14:63155654-63155676 ATGGGAAAAACCCAGTAGGAGGG - Intergenic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119113770 14:71999414-71999436 AGGAGAAATCAGAAGTATGATGG + Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119847289 14:77839940-77839962 AAAGGAAAAAAGAAGTAGGGAGG + Intronic
1119914864 14:78388718-78388740 CTTGGAAAACAGAAGTACAAAGG + Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120601053 14:86510412-86510434 ATAAGAAAACAGAAGTATGAAGG - Intergenic
1121166888 14:91810380-91810402 ATGAAAGAAGAGAAGTAGGAAGG + Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1124075718 15:26442759-26442781 ATGGGAAGAAGGAAGTAGGTAGG - Intergenic
1125825695 15:42674441-42674463 AAGGGACAACAAAAATAGGAAGG + Exonic
1125992610 15:44124368-44124390 AAGGAAAAAAAGAGGTAGGAAGG + Intronic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1128451245 15:67807021-67807043 TTAGGAAAACAGAAGTGGGCAGG - Exonic
1128687951 15:69700852-69700874 ATGGGAAAACAGAGGCTGTAGGG - Intergenic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1129478174 15:75801805-75801827 ATGCGAAAACAGATGTTGCATGG + Intergenic
1129645589 15:77428260-77428282 ATGGTAACAAAGAAGGAGGAAGG + Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131575675 15:93588280-93588302 AGGGAAGAATAGAAGTAGGAAGG - Intergenic
1131575682 15:93588324-93588346 AGGGAAGAATAGAAGTAGGAAGG - Intergenic
1132006845 15:98235082-98235104 ATGGGAAAACTGAACCAGGAAGG - Intergenic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1135050985 16:19192896-19192918 GTGGGAAATCAGAATTAGGGAGG - Intronic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137789650 16:51164384-51164406 ATGGCAAACAAGAAGTAGCATGG - Intergenic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1137928640 16:52565540-52565562 ATGGGAAATCAGTAGAAGGCAGG + Intergenic
1138074177 16:54024656-54024678 ATGGGAAAACCGAGGGAGAATGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1139270385 16:65676976-65676998 AGGGAAGAACAGAAGTTGGAAGG + Intergenic
1139355488 16:66364986-66365008 ATGGGAGCAGAGAAGTGGGAGGG - Intergenic
1140465355 16:75176791-75176813 AAGGGAAAAGAGGAATAGGAAGG + Intergenic
1140803633 16:78511915-78511937 ATGTGTAAACAGAAGTAGCTGGG - Intronic
1141008003 16:80371327-80371349 ACGGGAAAACAGGACTGGGAAGG + Intergenic
1141617267 16:85217102-85217124 ATGGGGAAACGGAAGCAGAAAGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143974752 17:10821600-10821622 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1145051089 17:19661573-19661595 ATGGGAAAACAGCACAAAGAAGG + Intronic
1145376705 17:22356389-22356411 ATGGGAAAAGAGATTAAGGAAGG - Intergenic
1145710081 17:26963364-26963386 ATGGGAGAAAAGAAGGAGGGCGG + Intergenic
1146291511 17:31610848-31610870 ATGGAAGAACAGAAGTACAAGGG - Intergenic
1147041329 17:37721594-37721616 ATGGGAAAAGAGAAGCAGCCGGG - Intronic
1147156205 17:38545562-38545584 ATGGGAAAACTGAGGCAGGGAGG + Intronic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148572482 17:48681224-48681246 CTCAGAAAACAGAAGTAGCATGG - Intergenic
1149008866 17:51834353-51834375 ATGGGAAAACAGGAAAAGAATGG + Intronic
1150054523 17:62001326-62001348 CTGGGAAATTAGAAGTAGCAGGG - Intronic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1151032989 17:70763414-70763436 CTGGGAACACAGAAGTCTGATGG - Intergenic
1151933761 17:77248858-77248880 AGGGGAAAACAGAAAAAGAAGGG - Intergenic
1152023693 17:77795323-77795345 ACAGGAAAAGAGAAGTGGGAGGG + Intergenic
1152231551 17:79116543-79116565 ATTGGAAAGCAGAAGTGAGAGGG + Intronic
1152318689 17:79595890-79595912 AATGGAAAACAGAAGTGGAATGG - Intergenic
1152358954 17:79821353-79821375 AAGGGAAAAATGATGTAGGAGGG - Intergenic
1152562453 17:81085372-81085394 ATGGGACAGCAGAGGAAGGAGGG + Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1154224890 18:12494399-12494421 ATGGTAGAACAGAAGGAGCATGG - Intronic
1155371281 18:25103741-25103763 ATGGGAAGAGAGAAGGAGTAAGG + Intronic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1156409394 18:36813206-36813228 AGGGGCAAAGAGAACTAGGAGGG + Intronic
1157910589 18:51614287-51614309 ATGGGTCAACAGGAGTAGGAAGG - Intergenic
1158153873 18:54403558-54403580 AATGGAAAACAGAAAAAGGAAGG - Intergenic
1158188488 18:54798387-54798409 ATGACAAAACAGAAGCATGAAGG + Intronic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158758701 18:60357688-60357710 CTGGGAACATAGAAGTAGAATGG - Intergenic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159742871 18:72194634-72194656 ATTGGAAAACAGAAGTTAAAAGG + Intergenic
1160270599 18:77379922-77379944 ATGGGAAGAGAGAATTAGGGAGG + Intergenic
1160854351 19:1209664-1209686 ATGGGAAGACAGACGCTGGAGGG + Intronic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1162153459 19:8661127-8661149 AAGGGAAAAAGGAAGAAGGAAGG - Intergenic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1162584534 19:11551097-11551119 ATGGGAAAACAGGTCTAGGGAGG - Intergenic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163246723 19:16100179-16100201 CGGGGAAAACAGACCTAGGAAGG + Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1164011184 19:21204711-21204733 ATGGGATAAAAGCAGGAGGAAGG - Intergenic
1164015836 19:21255250-21255272 ATGGGATAAAAGCAGGAGGAAGG + Intronic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165561560 19:36684976-36684998 AGGGGAAAACAGATGTAAAAAGG + Intergenic
1165951631 19:39476806-39476828 ATGGGAAAACAGATTTAGGTAGG - Intergenic
1166120765 19:40684914-40684936 GTGGGAAATCAGACGTAGGAGGG + Intronic
1166235087 19:41449921-41449943 ATGTGATAACAGAAGTAGGAGGG + Intergenic
1167337665 19:48896598-48896620 ATGGGAAGACAGAAGTGAGGTGG + Intronic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1168727089 19:58590958-58590980 ATGGGAAAATTTAAGTAGGTGGG + Intergenic
925617812 2:5760365-5760387 ATGGGAAAGCCAAAGTAGGAAGG - Intergenic
926024110 2:9524783-9524805 TTGGGAAAACTGGAGAAGGAAGG + Intronic
926447970 2:12968040-12968062 AAGGGAAAAGAGAAGTCTGAGGG + Intergenic
926543243 2:14206804-14206826 ATGGAAGCAAAGAAGTAGGAAGG + Intergenic
927578298 2:24219077-24219099 AGGAGGAAACAGAAGTGGGATGG - Intronic
927739658 2:25557080-25557102 ATGGCAGAACTGAAGTAGGAAGG + Intronic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928414824 2:31083462-31083484 ATAAGAAAACAGAACAAGGAGGG + Intronic
928712874 2:34027239-34027261 ATAGGAAAACAGAAGTTAAAAGG - Intergenic
929002568 2:37362649-37362671 ATATGAAGACAGAAGTTGGATGG + Intronic
929048313 2:37812576-37812598 ATGAGAAAACAGACGCAAGAGGG + Intergenic
929757292 2:44778416-44778438 AAGGGAAAACAGGAGTTGGAGGG + Intergenic
929784088 2:44976489-44976511 ATAGGAAAACTGAAGTACCAAGG - Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930430001 2:51263727-51263749 ATGAGAAAACAGAAGCAGATAGG + Intergenic
930982835 2:57548117-57548139 AAGGGAAAAAAGAGGAAGGAAGG + Intergenic
931420513 2:62122922-62122944 ATGGAACCACAGCAGTAGGAGGG + Intronic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
932911351 2:75809502-75809524 ATGGGAAAAAAGATCTATGAAGG - Intergenic
932980767 2:76663085-76663107 ATGGGAAAACTGAAGTTCAAAGG - Intergenic
933113774 2:78439767-78439789 ATAGGAAAACAGAATTATTAAGG + Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934119306 2:88824927-88824949 ATGGGAAGAGATAAGGAGGATGG + Intergenic
934671370 2:96215399-96215421 ATGGGAAACAGGCAGTAGGATGG - Intergenic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935946851 2:108294394-108294416 AGGGGAAAACAGAAGAGAGAGGG - Intronic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936162772 2:110097450-110097472 ATGGGAAGAGATAAGGAGGATGG + Intronic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936571465 2:113620235-113620257 ATGGGAAAATTTAAGTAGGTGGG - Intergenic
936683279 2:114799334-114799356 AAGAGAAAACAGAATTAGTAGGG + Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937286661 2:120758379-120758401 AGGGGAAAGCGGAAGTGGGAAGG + Intronic
937406495 2:121634125-121634147 ATGGGAAAACTGAAGAGGGATGG - Intronic
937489406 2:122350113-122350135 AATGGAAAACAGAAGAAGGCAGG - Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937834753 2:126460952-126460974 ATGGGAGAACAGGAGTGGGAGGG - Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
938661754 2:133494148-133494170 ATGGTAAAACAGAAATGGAAAGG - Intronic
938708281 2:133953026-133953048 AAGGGAGAACAGAAACAGGAAGG + Intergenic
938941992 2:136177527-136177549 TTGGGAAAACATCAGCAGGAGGG + Intergenic
939204184 2:139078775-139078797 AGGGGAAGACACAAGCAGGAGGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
940492799 2:154386287-154386309 GTGGGAAAACAGAATAAGGGAGG + Intronic
940598533 2:155826641-155826663 ATGGGAAAAATGATGTAGTATGG - Intergenic
941442552 2:165556083-165556105 AGGGGAAGACAGCAGTAGCAGGG + Intronic
941520841 2:166540269-166540291 AATGGAAAACAAAAGTTGGAGGG + Intergenic
941726350 2:168864852-168864874 ACGAGAAAAAAGAAGGAGGATGG + Exonic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
942117355 2:172741253-172741275 ATGTGAAAAGAGAAGTAAGCAGG - Intronic
942247776 2:174023732-174023754 ATAGGAAGACAGGAGAAGGAGGG + Intergenic
942480662 2:176384877-176384899 ATGGGGAAACAGAAGTGATAGGG + Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
942998051 2:182289041-182289063 ATGGACAACCAGAAGTAGCAAGG - Intronic
943444680 2:187969739-187969761 ATGGAAAAAAAGAAGTAGAAGGG + Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943781629 2:191830527-191830549 ACTGGAACACAGAAGTGGGATGG + Intergenic
943927078 2:193798701-193798723 ATGGGAAAAAAAAAGAAAGAAGG + Intergenic
944982941 2:205142961-205142983 ATGGGAAAACATAAGTGAAATGG + Intronic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946157352 2:217815686-217815708 ATGGGAGAAAAGCTGTAGGAAGG - Intronic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1169736339 20:8841566-8841588 ACGGAAAGACAGAGGTAGGAAGG - Intronic
1170341073 20:15327717-15327739 ATGAGAAAACAGCAGAAGTAGGG - Intronic
1171298720 20:24040930-24040952 AGGAGAAAACAGGAGTAGGTTGG - Intergenic
1172489191 20:35320719-35320741 ATGGGAAAACAGAAGAAAGTTGG + Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173564125 20:44027322-44027344 ACGGGGAAACATAAGAAGGAGGG - Intronic
1173770055 20:45648450-45648472 ATGGGACAGCAAAAGTTGGAAGG + Intergenic
1174559416 20:51419421-51419443 ATGGGAAAAAAGAGGAAGGAGGG - Intronic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175254862 20:57635335-57635357 ATGGGAAAAGAAAAGTAGTTAGG + Intergenic
1176901065 21:14442824-14442846 AATGGAAAACATAAGAAGGAAGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177675903 21:24297987-24298009 ATGGGAATACAGATGTCAGAGGG + Intergenic
1178037974 21:28606355-28606377 ATGGGCAAACATAATTTGGATGG - Intergenic
1179092813 21:38283328-38283350 AAAGGAAAACAAAATTAGGAAGG - Intronic
1179416866 21:41205575-41205597 AAGACACAACAGAAGTAGGAAGG - Intronic
1179594289 21:42431553-42431575 ATGGGAAAACAGCAAGGGGATGG + Intronic
1180262529 21:46682762-46682784 ATGGGAAAATTTAAGTAGGTGGG + Intergenic
1181296716 22:21846024-21846046 ATGGGGAAACAGACCTAGGCAGG + Intronic
1181296783 22:21846694-21846716 ATGGGGAAACAGACCTAGGCAGG - Intronic
1181336817 22:22141435-22141457 ATGGGGAAACAGAACTAGGCAGG - Intergenic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1182350034 22:29694226-29694248 CTGGGAAACCAGGAGTAGAAGGG + Intronic
1183691877 22:39394794-39394816 ATGGGATGAGAGAAGTAGCAAGG - Intergenic
1183799700 22:40151941-40151963 AGGAGAGAACAGAAGTTGGAAGG + Intronic
1184791077 22:46700427-46700449 ATGCAAAATCAGAAGTAGGCCGG + Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185409773 22:50675336-50675358 GTGGGGAAACACAAGTGGGAGGG + Intergenic
1185428727 22:50790639-50790661 ATGGGAAAATTTAAGTAGGTGGG + Intergenic
1203289113 22_KI270735v1_random:17240-17262 ATGGGAGAAAAGAAGGAGGGCGG - Intergenic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949209416 3:1479780-1479802 AATGGAAAACAAAAGTAGGCAGG + Intergenic
949486853 3:4547991-4548013 ATGAGAAATAAGAAGTAGAATGG - Intronic
949642514 3:6054205-6054227 ATGGGCAAAGAGAAGTAGGGTGG - Intergenic
949789334 3:7775811-7775833 ATGGGTAGTCAGAAGTAGGTAGG + Intergenic
950119106 3:10470079-10470101 ATGGGAAAACAGACCTGGGAGGG + Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950753877 3:15155952-15155974 GGGAGAAAAGAGAAGTAGGAAGG + Intergenic
951423572 3:22516456-22516478 ATGGGAAAAAAAATGTAGGCTGG - Intergenic
952064277 3:29549046-29549068 AAAAAAAAACAGAAGTAGGAGGG - Intronic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
953706125 3:45231875-45231897 ATGAGAAAACAGGTGCAGGAAGG + Intergenic
954499927 3:51002735-51002757 AAGGGAATAAACAAGTAGGAGGG - Intronic
955010480 3:55009798-55009820 CTGTGAAAACAGAAATAGAATGG - Intronic
955311168 3:57888091-57888113 ATAAGAAAACAGAAAGAGGAAGG + Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955672650 3:61418151-61418173 ATGAGAAAACAGAGGCAGGGAGG + Intergenic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
957535558 3:81498240-81498262 GTGGGAAAACAGTAGAAAGATGG + Intronic
957613722 3:82502437-82502459 AGGAGAAAACAAAAGCAGGAAGG + Intergenic
958259768 3:91367058-91367080 ATAGGGAAACTGAAGCAGGAGGG + Intergenic
958429162 3:94017901-94017923 ATGGGAAGAATGAAGTAGAAAGG + Intronic
958906001 3:99942895-99942917 AGGGGAGAAAAGAAGAAGGAAGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960189404 3:114685070-114685092 ATGGGAAAACAGAATGATGTAGG - Intronic
960406056 3:117261490-117261512 TTGGGAAAAGAGAAGTTGTAAGG - Intergenic
960551897 3:118985288-118985310 ATGAGAGAACTGAGGTAGGAGGG + Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961631815 3:128306785-128306807 ATGAGAAAACTGACTTAGGAAGG + Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962097257 3:132304877-132304899 ATGGGGAAAAAAAAGTAGGGGGG + Intergenic
962417525 3:135196720-135196742 GTGGGAAAGGAGAAGTTGGAGGG - Intronic
962506243 3:136048992-136049014 ATGGTAAAACGGAAACAGGAAGG - Intronic
962803634 3:138911124-138911146 GCTGGAAAATAGAAGTAGGAAGG - Intergenic
962893137 3:139690547-139690569 ATGGAAAATCACAAGTGGGATGG + Intergenic
963224764 3:142851041-142851063 AAGGGAAGACAGATGTAGGTAGG + Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
963688497 3:148469079-148469101 ATATGAAAACAGAAACAGGAAGG + Intergenic
964212507 3:154244253-154244275 ATGTAAAATCAGCAGTAGGAGGG + Intronic
964924552 3:161939555-161939577 ATGAGACCAGAGAAGTAGGAGGG - Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965722153 3:171673844-171673866 ATGTGGGGACAGAAGTAGGATGG - Intronic
965852335 3:173043189-173043211 ACTGGAAAACAGAAGCATGATGG - Intronic
966331746 3:178822378-178822400 ATGGGAATAGAGAAGAGGGAAGG - Intronic
966555600 3:181257156-181257178 ATGGGATTACTGCAGTAGGAAGG - Intergenic
967294830 3:187954696-187954718 AAGGGAAAATGGAAGTGGGAGGG + Intergenic
967787910 3:193517405-193517427 CTGGGACAACAGGAGTAGGTGGG + Intronic
967900196 3:194442038-194442060 ATGAGAAAACTGAAGCAGGGTGG + Intronic
967934610 3:194716849-194716871 AAGGGGAAACAGAAGTACCAAGG + Intergenic
968141869 3:196264711-196264733 TTGAGAAAAAAGGAGTAGGAAGG - Intronic
968374123 4:23645-23667 ATGGGAAAATTTAAGTAGGTGGG - Intergenic
968508404 4:983060-983082 ATGGGAAAAGTGAAGTGAGAGGG - Intronic
970186230 4:13456228-13456250 AGGGGAGAACAGAAATAAGATGG + Intronic
970365211 4:15351258-15351280 AGGAGAAAACAGAGGAAGGAAGG - Intronic
971661641 4:29425127-29425149 AGGGTAAAACAGAAGTAGGTAGG + Intergenic
971688211 4:29798721-29798743 ATTGGAAAATAGAAGTAGGAAGG - Intergenic
972008777 4:34148032-34148054 ATGGGAAAAGAAAAATAGGTAGG - Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973139541 4:46749404-46749426 TTGGGAAAATAGATGGAGGATGG - Intronic
974062818 4:57051134-57051156 ACGGGAAAAGAATAGTAGGAAGG + Intronic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
974938788 4:68439141-68439163 ATGGGAAAACAGATGAAGAAAGG + Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
975579405 4:75893051-75893073 ATGGGAAAAGAGAAGCTGGGAGG + Intronic
976022976 4:80653086-80653108 CTGAGAAAAGAGATGTAGGATGG - Intronic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976822765 4:89225557-89225579 ATGGGAGAACAGAATTTGGAGGG + Intergenic
977373004 4:96164041-96164063 TTGGGAAAATAGCAGAAGGAAGG - Intergenic
977548050 4:98408859-98408881 TTAGGAAAACAGGACTAGGAAGG + Intronic
977797458 4:101184009-101184031 ATGGGAAGACAAAAGTAGCTAGG + Intronic
977888664 4:102281330-102281352 ATGAGAAAACAGGGGTAGGATGG + Intronic
977912833 4:102557739-102557761 GTGGGAAAAGAGAAGTACAAGGG + Intronic
978215876 4:106202323-106202345 ATAAGAAAACAGAAGAATGATGG + Intronic
978542351 4:109831616-109831638 ATAGGAAAAGAGAAGGAGCAGGG + Intronic
979940921 4:126761916-126761938 ATGCACACACAGAAGTAGGAAGG + Intergenic
980094461 4:128474999-128475021 AAGGAAAAAAAGAACTAGGAGGG + Intergenic
981256950 4:142673036-142673058 ATAGGCTCACAGAAGTAGGATGG - Intronic
981616885 4:146651806-146651828 AGGGGAAAATGGAAGGAGGAAGG - Intergenic
982324600 4:154117164-154117186 ATCAGAAGACAGAACTAGGAAGG + Intergenic
982381260 4:154751279-154751301 ATGGGAAAAGGAAACTAGGATGG + Exonic
982607272 4:157530515-157530537 ATGGGAAAACAGAAATGGGGTGG - Intergenic
982828941 4:160036021-160036043 ATGGGATAACAGGCATAGGATGG + Intergenic
984100696 4:175481985-175482007 ATGTGAAAACAGAGGAAAGATGG - Intergenic
984476114 4:180237205-180237227 ATGAGAAGCAAGAAGTAGGAAGG + Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985460607 4:190102618-190102640 ATGGGAAAATTTAAGTAGGTGGG + Intergenic
985465172 4:190187736-190187758 ATGGGAAAATTTAAGTAGGTGGG + Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
986317460 5:6600089-6600111 TTGGGAGAAAAGAAGAAGGAAGG - Exonic
986798841 5:11239445-11239467 CTGGGAGAACAGAAGTGGGGAGG - Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
986886692 5:12246521-12246543 ATGGGAAAACAGAAGACAGATGG + Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987764022 5:22201952-22201974 GTGGGAAGTCAGAAGTGGGAAGG + Intronic
987937289 5:24482426-24482448 ATGGGAAAACAGCAGAAGAGAGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
990867913 5:60400184-60400206 ATGGTAAAACAGAAGTGGATGGG + Intronic
990944787 5:61238556-61238578 ATGGCAAAGCAGAAGCAGCATGG - Intergenic
991534750 5:67656000-67656022 ATGGGGTAACAGAGGTAGGGTGG + Intergenic
991621530 5:68550297-68550319 CTAGGAAAACAGAAGAAGTAAGG + Intergenic
991679836 5:69127822-69127844 ATGAGAAGCCAGAAGCAGGAAGG - Intronic
992417193 5:76562904-76562926 ATGTGATAAAACAAGTAGGAAGG + Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
992944896 5:81800345-81800367 ATGGGATCCCAGTAGTAGGAGGG + Intergenic
993347307 5:86800268-86800290 TTGTGAAAACAGAAGCAGAAAGG + Intergenic
993545602 5:89208771-89208793 ATGGGAAAACAAAAGTAGTTTGG - Intergenic
993895945 5:93534637-93534659 ATGAGAAAAAAGAGGTAGGAAGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994384617 5:99115672-99115694 ATGGGAAAATAGAAGTGGATAGG + Intergenic
994598289 5:101867736-101867758 ATGGAAAAACAGAAATCAGAGGG + Intergenic
996221303 5:120936410-120936432 GTGTTAAAACATAAGTAGGATGG - Intergenic
996778391 5:127157926-127157948 AATGGAAAACAGAAAAAGGAAGG - Intergenic
997621794 5:135303922-135303944 ATGGGCAAACACAAGCAAGATGG - Intronic
998387267 5:141764675-141764697 ATGAGAAAACAGAAGCAGAGAGG - Intergenic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998547598 5:143044297-143044319 ATGAGAAGCCAGAAGAAGGAAGG - Intronic
998701804 5:144711307-144711329 GTGAGAAAAGAGAAGTGGGAAGG - Intergenic
999049916 5:148511155-148511177 ATTCGAAAAAAGAAGAAGGATGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
1000818238 5:165951047-165951069 ATAGTAAAAAAGTAGTAGGATGG + Intergenic
1001126814 5:169027051-169027073 ATGGGTAGACAGACTTAGGATGG + Intronic
1001602273 5:172936698-172936720 ATGTGAAAAGCCAAGTAGGACGG + Intronic
1001656764 5:173356631-173356653 ATGGGAAAACACAAGTATGTTGG + Intergenic
1002598250 5:180338303-180338325 ATGGAAAAATAGAAGAAGCAAGG - Intronic
1002856470 6:1042504-1042526 TTGGGCAAACAAATGTAGGAAGG + Intergenic
1003024059 6:2537753-2537775 TTGAGAAAACAGAAGCAGAAAGG - Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004692044 6:18000692-18000714 TATGGAAAACAGTAGTAGGAAGG + Intergenic
1005080108 6:21948147-21948169 ATAGGAAAAAAGAAGTAGGTTGG + Intergenic
1005167588 6:22942290-22942312 ATAGAAAAACAGAAGAATGAGGG + Intergenic
1005431402 6:25761647-25761669 ATGGGAACACAGAACTAGAAAGG + Intronic
1005505140 6:26463113-26463135 ATAGGAAACAAGAAATAGGAAGG - Intronic
1006079569 6:31557675-31557697 ATGGGAATAAAGAATAAGGATGG + Exonic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006808386 6:36803950-36803972 ATGAGAATACAGCAGGAGGAAGG + Intronic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1007184873 6:39961221-39961243 ATGGGAAATGAGAAACAGGAAGG - Intergenic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1008041652 6:46807720-46807742 AGAGGAAAACAGAAGAAGGAGGG + Intronic
1008283285 6:49621094-49621116 ATGGCAGAACAGAAGTAGAGAGG - Intronic
1008395471 6:51001689-51001711 ATGTGAAAAAAGAAGTGGGCTGG + Intergenic
1009043109 6:58205288-58205310 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009218946 6:60959537-60959559 ATGGAAGAACAGCAGCAGGAGGG - Intergenic
1009332713 6:62443863-62443885 AATGGAAAACAGAAGAAAGAAGG - Intergenic
1009793931 6:68441673-68441695 ATGGAAAGACAAAATTAGGAAGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010465311 6:76161243-76161265 ATGGGAACCAAGAAGAAGGATGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1010711513 6:79180630-79180652 ATGGAAAAAAAGAACTAAGATGG - Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1011754142 6:90482194-90482216 TTAAGAAAACAGAAGCAGGAAGG - Intergenic
1011912179 6:92454209-92454231 ATAGGAAAAAAGAAAAAGGAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1013127787 6:107201905-107201927 GGGGGAAAACAGAAGTGGTAAGG - Intronic
1015637761 6:135295713-135295735 AAGGGAAGAAAGATGTAGGAGGG + Intronic
1016154334 6:140784825-140784847 ATGGGAAAAGACAAGGGGGAAGG + Intergenic
1016514757 6:144881568-144881590 TTGGAAAAATAGAATTAGGAAGG + Intergenic
1016943182 6:149501261-149501283 AGGAGAAAACAGAAGTGGCAGGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017679322 6:156847442-156847464 ATGGGAGATCTGAAGTGGGAAGG + Intronic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018452299 6:163920257-163920279 ATGGCAAAACGGAAGGATGATGG - Intergenic
1019038062 6:169078611-169078633 GTGGGACAACACAACTAGGAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019410311 7:903900-903922 ATGGGAAGACAGGTGCAGGAAGG - Intronic
1019675680 7:2310892-2310914 ATGTGAAAACAGAACTAAAACGG + Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1021317830 7:19171726-19171748 ATGGGAAGAAAGGAGTAGGAGGG + Intergenic
1022233312 7:28436279-28436301 ATTGGAAAACATAAGTGGAAAGG - Intronic
1023148235 7:37174193-37174215 ATAGGAAAAAGGAAGTGGGAGGG - Intronic
1023632562 7:42178763-42178785 ATGGGAAAATAAAAGTAGAGTGG + Intronic
1023642470 7:42273714-42273736 ATGGGCAAACATAATTTGGATGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1027049077 7:75010318-75010340 AGGGGAAGACAGAGGTAGGCAGG + Intronic
1027332857 7:77117653-77117675 ATAAGAAAACAGAAGAATGATGG + Intergenic
1027436442 7:78169636-78169658 AGGGGAAAGCAGAAGTAGTGTGG - Intronic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028198789 7:87936385-87936407 ATGGTAAAACTGAAGAAGCAGGG + Intronic
1028322166 7:89473704-89473726 ATGGGAAAACTGATGAAGGTTGG + Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029132462 7:98342792-98342814 AAGGGAAAACAGAAATGGTAAGG - Intronic
1029383942 7:100231341-100231363 AGGGGAAGACAGAGGTAGGCAGG - Intronic
1029782927 7:102753644-102753666 ATAAGAAAACAGAAGAATGATGG - Intronic
1030340704 7:108376619-108376641 ATAGGAAAAGAGAATTAGGCAGG - Intronic
1030880121 7:114867472-114867494 ATGACAAAAGAGAAGAAGGAGGG - Intergenic
1031009435 7:116510185-116510207 ATGGGTACACAGGAGTAGCACGG - Intergenic
1033202836 7:139388722-139388744 ATGGGAAAACTGATCTATGAGGG - Intronic
1033415135 7:141155332-141155354 AGGGAAAAACAGAATTAGCAAGG - Intronic
1034238680 7:149592745-149592767 AAGGGAAAACCAAAGTAGGTGGG + Intergenic
1034594985 7:152181340-152181362 ATGGGTCAACAGTAGTAGGCCGG + Exonic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1037319528 8:17630160-17630182 TGGGGAAAACAGAAGAAAGACGG - Intronic
1037640297 8:20736181-20736203 ATGGGAAAATAGAAGTGGAGAGG + Intergenic
1038322798 8:26543989-26544011 TTGGGTTGACAGAAGTAGGAAGG - Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038625189 8:29185727-29185749 ATGTAAAAACAGCATTAGGAAGG - Intronic
1038954527 8:32452672-32452694 ATGGAAAAACAGAAGTATAGAGG + Intronic
1039137362 8:34340339-34340361 ATGTTCAAACTGAAGTAGGAAGG - Intergenic
1039235407 8:35497395-35497417 TTGAGAAAACAGCAGTAGGGAGG - Intronic
1039593079 8:38767180-38767202 TTGAGAAAACAAAACTAGGAAGG + Intronic
1040779511 8:51091493-51091515 ATCAGAAAACTGAAGTTGGAGGG + Intergenic
1041054763 8:53973153-53973175 ATGGGAAAACAAAAGTCAGAAGG + Intronic
1041418502 8:57641074-57641096 ATGGGACCAGAGGAGTAGGATGG + Intergenic
1041479461 8:58302651-58302673 ATGGGAAAAAGGAAGAGGGAAGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042507326 8:69574507-69574529 ATGTGAATACAGCAGTAGCAGGG - Intronic
1044295734 8:90525154-90525176 ATGGGAAAATAGAAGAACAAGGG - Intergenic
1044661269 8:94593442-94593464 ATAAGAAAACAGAAGTGGGCCGG + Intergenic
1045076128 8:98570826-98570848 ATGGTAAAACTGAAGTAGAGAGG + Intronic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1046105420 8:109659683-109659705 GTGGAAAAACAGTAGTAGAAGGG - Intronic
1046476104 8:114745897-114745919 ATAGAAAAACAGAGGAAGGAAGG + Intergenic
1047441110 8:124879482-124879504 ATTGAAAAACAGACGTAGGCAGG + Intergenic
1047628953 8:126684812-126684834 GTGGGAGAACAGAAACAGGATGG - Intergenic
1047814021 8:128442939-128442961 ATAGGATAACAGTAGCAGGAAGG - Intergenic
1047946511 8:129886386-129886408 AAAGAAAAACTGAAGTAGGAAGG - Intronic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048165648 8:132059230-132059252 ATGGGAGAAGAGAAGAAGGGAGG - Intronic
1048357034 8:133661982-133662004 ATGGGAAAAAAGAACGAGGGTGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1050264790 9:3878874-3878896 ATTGGGAAACAGAAGTATGAAGG + Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1050612752 9:7370340-7370362 AAGGGAAAAACAAAGTAGGAAGG + Intergenic
1051319338 9:15883861-15883883 ATAGGAAAAAATAATTAGGAAGG + Intronic
1052165601 9:25323059-25323081 ATGCGAAAACAGAAATGGTAGGG - Intergenic
1052638064 9:31128394-31128416 ATGGAAACACATAAATAGGAAGG + Intergenic
1053052136 9:34970924-34970946 ATGGGAAAACCAAAGTTGCAAGG + Intronic
1055194555 9:73572791-73572813 GTGTGAAAACTGAAGTGGGAAGG + Intergenic
1055526502 9:77139096-77139118 ATAGGAAAATAGAAGTAGAATGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056722976 9:89087432-89087454 AGAGGAAAACAGAAGTGTGATGG + Intronic
1057006122 9:91561879-91561901 TTAAGAAAACAGAAGTGGGATGG + Intergenic
1057011411 9:91605659-91605681 ATGAGAAAAAAGAGGTAGAATGG + Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057464986 9:95304774-95304796 AAGGGAAAACAGAAGAAATAAGG + Intronic
1057980154 9:99652440-99652462 AATGGAAAACAGAAAAAGGAGGG + Intergenic
1058102379 9:100931679-100931701 ATGGGAATGAAGAACTAGGAGGG + Intergenic
1058330014 9:103748924-103748946 AGGGGAAAAAAGAAGTGGAAGGG + Intergenic
1058352627 9:104043966-104043988 ATGGGAAAAGAGAGGCAGGAGGG + Intergenic
1058622062 9:106893704-106893726 ATGAGACAACAGAAATAGCAGGG - Intronic
1058999119 9:110329947-110329969 AGAACAAAACAGAAGTAGGAGGG - Intronic
1059229825 9:112709377-112709399 ATGGGAAAACAGAATGAATAAGG + Intronic
1059513789 9:114874436-114874458 ATGGGAAAACAGACACAGCAAGG + Intergenic
1059715940 9:116913395-116913417 ATGAGAAAACAGAATTAATAAGG - Intronic
1059717354 9:116925677-116925699 ATGGAAAAATAGGAGTAGCAGGG - Intronic
1060068949 9:120529726-120529748 ATGGTAAAACAGAGGTAAGCAGG + Intronic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1060431688 9:123556267-123556289 ATGGATAAAAAGGAGTAGGAGGG + Intronic
1060952008 9:127609972-127609994 ATGGGAAAACGGTGGTAAGAGGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061697281 9:132386160-132386182 ACTGGAAAACTGAAATAGGAGGG + Intronic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1185714484 X:2330219-2330241 AAGGGAAAAAAAAAGTAGAAGGG + Intronic
1185714582 X:2330715-2330737 AGGGGAAGGAAGAAGTAGGAGGG + Intronic
1185762543 X:2699848-2699870 ATGGGAAATCTCATGTAGGAGGG - Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186301482 X:8204525-8204547 ATGGGAATAGTGAAATAGGAAGG - Intergenic
1187393983 X:18904215-18904237 AGTGGAAAACAGAAGGAGAAGGG + Intronic
1187479899 X:19645861-19645883 CTGGAAAAATGGAAGTAGGAGGG + Intronic
1187979397 X:24739064-24739086 ATGGGAAAACAGCAGGGTGAGGG - Intronic
1188277944 X:28224223-28224245 ATGGGCAAACTGAAGTTGGAGGG + Intergenic
1188914486 X:35892667-35892689 TTGGGGAAACACATGTAGGAGGG + Intergenic
1189596351 X:42570524-42570546 ATAGGTCAACAGAAGTAGCAAGG - Intergenic
1189769481 X:44409549-44409571 ATGGCAAAACAGAAGCTGGTAGG - Intergenic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1190789102 X:53683252-53683274 ATGGGACGACAGAATTAGGAGGG + Intronic
1191764453 X:64682111-64682133 GAGGGAAAACAGAACTAGGGAGG + Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192709734 X:73567360-73567382 TTGCGAATACAGAAATAGGAAGG - Intronic
1192746466 X:73943729-73943751 ATGGGAAAACAGAAACCAGAGGG - Intergenic
1193138589 X:78001090-78001112 ATGGGCAAACAGAAATAGAAGGG - Intronic
1193361770 X:80587174-80587196 AAGGGCAAGCAGAAGTAGGGTGG - Intergenic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1193688950 X:84615685-84615707 ATGGGAAATTAGAAGTAGAATGG - Intergenic
1195742050 X:108074768-108074790 ATGGGAAAGCTGAAGCATGACGG + Intronic
1196122523 X:112066182-112066204 ATAGGAACACAGAAGCAGAAGGG - Intronic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1197816933 X:130507307-130507329 ATGGGGCAACAAAAGAAGGATGG - Intergenic
1198606070 X:138339117-138339139 ATAGGAGAAAAGTAGTAGGAGGG + Intergenic
1198696128 X:139340517-139340539 ATGGCAAAACAGAAAAAGTAGGG + Intergenic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1198847876 X:140932083-140932105 ATCCGCAAACAGGAGTAGGAGGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199410803 X:147519916-147519938 ATGGGAAAACAGAAAAAAGCAGG + Intergenic
1199490007 X:148387594-148387616 AAGTGAAAACAGAGGTAGGCAGG - Intergenic
1200740412 Y:6847665-6847687 ATGGGAACAGAGAAGGAGAAGGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic