ID: 1158370839

View in Genome Browser
Species Human (GRCh38)
Location 18:56801848-56801870
Sequence CAACCCAGATGTCCCTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1381
Summary {0: 1, 1: 4, 2: 32, 3: 247, 4: 1097}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158370839_1158370841 30 Left 1158370839 18:56801848-56801870 CCTGTTTAGGGACATCTGGGTTG 0: 1
1: 4
2: 32
3: 247
4: 1097
Right 1158370841 18:56801901-56801923 TCCAGTAGCTATTCATGTACAGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158370839 Original CRISPR CAACCCAGATGTCCCTAAAC AGG (reversed) Intronic
900860963 1:5230676-5230698 CAACCCAGATATTCATCAACAGG + Intergenic
901121905 1:6902320-6902342 CAACCCAAATGTCATTCAACTGG + Intronic
901126471 1:6932416-6932438 TAACCCAAATGTCCATCAACAGG - Intronic
901437257 1:9255088-9255110 CAACCCAAATGTCCACTAACTGG - Intronic
901616638 1:10545235-10545257 CAACCCAAATGTCCATCAACAGG - Intronic
901731302 1:11281997-11282019 CAATCCAAATGTCCCTGAAAAGG - Intronic
901937944 1:12639925-12639947 CAATCCAAATGTCCATCAACCGG - Intergenic
901941058 1:12662021-12662043 CAACCCACATGTCCATGAACGGG + Intronic
902161345 1:14532866-14532888 CAACCCAAATGTCCAACAACAGG - Intergenic
902254555 1:15179325-15179347 CATCCCAGCTGTCCCTCAGCAGG + Intronic
902302927 1:15515511-15515533 CAACCCACATGTCCATCAATAGG + Intronic
902903612 1:19537645-19537667 CAACCAAGATGTCCTTTGACAGG - Intergenic
903029096 1:20450015-20450037 CAACCCAAATGTCTATCAACTGG + Intergenic
903272522 1:22198959-22198981 CAACCAAGATGTTCCTCAAAAGG - Intergenic
903412149 1:23153923-23153945 CAACCCAAATGCTCCTCAACTGG + Intronic
903687734 1:25144538-25144560 CAATCCAGATGTCCTTCAACGGG + Intergenic
903855016 1:26331972-26331994 CAGCCCAGATGTCCATCAATAGG + Intronic
903997085 1:27313836-27313858 CAACCAAGATGCCCCTCAAAAGG + Intergenic
904257531 1:29265001-29265023 CAGCCCAGATGTCATTCAACAGG - Intronic
904309152 1:29614601-29614623 CAACCAAGATGTCCCTCAACAGG - Intergenic
904309483 1:29618909-29618931 CAACACAAATGTCCATCAACTGG - Intergenic
904339130 1:29822159-29822181 CAACCCAGATGTCCTTCAGTAGG - Intergenic
904406448 1:30292760-30292782 CAACCAATATGTCCTTAAATAGG + Intergenic
904458131 1:30659287-30659309 GAACCCAGAAGTCCCTAGAGAGG + Intergenic
904481169 1:30794351-30794373 CAACCCAAATGTCCATCCACAGG + Intergenic
905050767 1:35048959-35048981 CAACCCAAATGTCCATCAATTGG - Intergenic
905209436 1:36363483-36363505 GAACCTAGATGTCCATAAATAGG - Intronic
905595565 1:39203842-39203864 CAACCCAAATGTCCATCAACTGG - Intronic
905681018 1:39870881-39870903 AAACCCAGATGTCCTTTAATAGG + Intronic
906359841 1:45145413-45145435 CAACCCAAATATCCTTTAACAGG + Intronic
906394470 1:45449440-45449462 CAACCAAGATGTCCTTCAATAGG + Intronic
906467697 1:46098441-46098463 CAACCCAAATATCCATTAACTGG + Intronic
906504136 1:46365242-46365264 CAACTCAAATGTCCATCAACTGG - Intergenic
906713013 1:47945805-47945827 CAACCCAAATATCCCTAAACTGG - Intronic
906887207 1:49661908-49661930 CAACCCAAATGTCTATCAACAGG + Intronic
906968291 1:50482368-50482390 CAGCTCAGGTGTCCCTCAACTGG - Intronic
908016865 1:59849862-59849884 CAACCCAAATGTTCATAAACTGG - Intronic
908215023 1:61943005-61943027 CAAGCCAAATGTCCATCAACTGG + Intronic
909795074 1:79724333-79724355 AAACTCAGATGTCCTTAAATGGG + Intergenic
909899765 1:81118311-81118333 CCACCCAAATGTCCATCAACAGG - Intergenic
909911369 1:81261674-81261696 CAACCAAGATGTCCTTCAATAGG + Intergenic
910222882 1:84906478-84906500 CAACACAAATGTCCATCAACAGG + Intergenic
910246722 1:85146514-85146536 CAACCCAAATGCCCATAGACTGG - Intergenic
910890089 1:92009454-92009476 CAACCAAGATGTCCTTCAATAGG - Intronic
910909979 1:92223066-92223088 CAACCCAAATGCCCCCCAACAGG - Intronic
911409724 1:97488016-97488038 TAACCCAGATATCCTTCAACAGG + Intronic
911595087 1:99790472-99790494 CAACCCAAATGTCCTTTAGCTGG - Intergenic
911637549 1:100251684-100251706 CAGCCCAGATGTCCATTAACAGG + Intergenic
911851301 1:102824834-102824856 CAACTCAGATGTCCTTCAATGGG - Intergenic
912660222 1:111521186-111521208 CAATCCAGATGTCCATCAATAGG - Intronic
913071986 1:115307629-115307651 GAACCCAGATTTCACTGAACTGG + Intronic
913171388 1:116235310-116235332 AAACCCAGATGTCCATGAACAGG + Intergenic
913309566 1:117475071-117475093 CAACCTAAATGTCCATCAACAGG - Intronic
914077900 1:144373841-144373863 CAACCAAGATGTCCTTCAATAGG - Intergenic
914101279 1:144592664-144592686 CAACCAAGATGTCCTTCAATAGG + Intergenic
914172809 1:145242381-145242403 CAACCAAGATGTCCTTCAATAGG - Intergenic
915613895 1:157019608-157019630 CAGCCCAGATGTCCATGAACAGG + Intronic
915656372 1:157364418-157364440 CAACCCAAATATCCCTTAATAGG + Intergenic
916300796 1:163271688-163271710 CAATCCAAATGTCCATCAACTGG - Intronic
916544176 1:165786298-165786320 CAACCCAAATGCCCATTAACAGG + Intronic
916668238 1:166987419-166987441 CAACCCAAATGTTCATCAACAGG - Intronic
917093755 1:171380064-171380086 CAATCCAAATGTCCATCAACTGG - Intergenic
917141467 1:171840334-171840356 CAACCCAAATGTCTATCAACAGG - Intergenic
917911825 1:179655858-179655880 CAACCCAAATGTCCTTCAATGGG - Intronic
918261579 1:182801132-182801154 CAACCTAGATCTCTCTAAAGAGG + Intronic
918418159 1:184333977-184333999 CAACCCAAATGTCCATCAACTGG + Intergenic
918732908 1:188020980-188021002 CAACCTAGATGCCCATCAACTGG - Intergenic
918921003 1:190709562-190709584 CTACCCAGATGTCTTTCAACAGG - Intergenic
919037014 1:192325363-192325385 CAACCAAGATGTCCATCAACTGG - Intronic
919382776 1:196878990-196879012 CAACCCAGATGCCCATGAGCTGG + Intronic
919628253 1:199933934-199933956 TAACCCAAATGTCCATCAACTGG + Intergenic
920136747 1:203775666-203775688 TAACCCAGATATCCTTCAACAGG + Exonic
920276541 1:204809499-204809521 TAGCCCAGATGTCCTTCAACAGG - Intergenic
920404530 1:205699200-205699222 CAACCCAAATGTCCTTTGACAGG + Intergenic
920483868 1:206350025-206350047 CAACCCAAATGTCCATCAACAGG + Intronic
920531974 1:206708987-206709009 CAGCCCAAATGTCCATCAACAGG - Intronic
920757284 1:208745229-208745251 CAACCAAGATGTTCTTAATCAGG + Intergenic
921267329 1:213432883-213432905 CAACACAGATGTTCATCAACAGG - Intergenic
921698529 1:218240426-218240448 CAGCCCAAATGTCCATCAACAGG + Intergenic
921735697 1:218625484-218625506 CAAACCAAATGTCCTTCAACAGG + Intergenic
921998728 1:221451748-221451770 CAACCCAAATGTCCATCAACTGG - Intergenic
922164310 1:223102178-223102200 CAACCCAGGTGTCCCTCAACAGG + Intergenic
922172061 1:223163825-223163847 CATCCTAGATGTCCATCAACAGG + Intergenic
922343418 1:224676085-224676107 CAACCCAAATATCCTTTAACAGG + Intronic
922637423 1:227188474-227188496 CAACCAAGATGTCCTTAAGTAGG + Intronic
922874551 1:228929976-228929998 CAATCCAAATGTCCCTCAACAGG + Intergenic
922918672 1:229281025-229281047 CAACCCAGATGTTCTTTAACAGG - Intronic
923059597 1:230458562-230458584 CAACCCAAATGTCTATCAACAGG - Intergenic
923169561 1:231401723-231401745 CAACCCAAATGTCCATCATCTGG - Intronic
923321708 1:232840554-232840576 CAGCCCAAATGTACATAAACAGG - Intergenic
923795031 1:237145396-237145418 CAACCCAGTTGTCCACAGACAGG - Intronic
924083994 1:240429803-240429825 AAACCCAAATGTCCATGAACAGG - Intronic
924184449 1:241473038-241473060 CAACCAAGATGTCCTTCAATAGG - Intergenic
924622094 1:245671241-245671263 CAACCTAAATGTCCATCAACAGG - Intronic
924662371 1:246033144-246033166 CAACACAGATGTCCTTCAAAGGG + Intronic
924681537 1:246239486-246239508 CAACCCAAGTGTCCATAGACTGG - Intronic
1063089982 10:2855947-2855969 CAACTCAAATGTCCTTCAACAGG + Intergenic
1063521606 10:6746469-6746491 CAACCCAAATGTCCATCAATAGG - Intergenic
1063912054 10:10840106-10840128 CAACCAAGATGTCCTTCAACAGG - Intergenic
1064171655 10:13038959-13038981 CAATCCAGAAGAACCTAAACAGG + Intronic
1064369662 10:14740199-14740221 CAACCAAGATGTCCTTCAATAGG + Intronic
1064387731 10:14912515-14912537 CAACCCAGATGTCCATCAGCTGG + Intronic
1065062862 10:21925530-21925552 CAACCCACATGTCCATCAACTGG + Intronic
1065098356 10:22306074-22306096 CAATCCATATGTCCATCAACTGG + Intergenic
1065170260 10:23020026-23020048 CAACTCAAATGTCCTTTAACAGG - Intronic
1065500133 10:26372913-26372935 CAACACAAATGTCCATCAACTGG - Intergenic
1065629787 10:27666919-27666941 AAACCCACATGTCCATCAACAGG + Intergenic
1065948816 10:30632834-30632856 CAACCAAGATGACCTTCAACAGG + Intergenic
1066462725 10:35625692-35625714 TAACCCAGATGCCCATCAACAGG - Intergenic
1066510094 10:36085604-36085626 CAACCAAGATGTCCTTCAATAGG - Intergenic
1066672144 10:37851918-37851940 TAACCCAGAGGTCCTTCAACAGG + Intronic
1067710500 10:48647781-48647803 CAACCCAAAAGTCCATCAACGGG + Intronic
1068544308 10:58328640-58328662 CAACCCAAATGTCCATCAATTGG - Intergenic
1069341762 10:67417949-67417971 CAACCCAAATGTCCATCAACTGG + Intronic
1069636509 10:69928578-69928600 CAACCCAAATGCCCATCAACAGG - Intronic
1069670802 10:70201415-70201437 CAGCCCAGATGTCCTTCAACAGG + Intergenic
1069689207 10:70338529-70338551 CAACCCAAATGTCTATCAACTGG - Intronic
1069689605 10:70341394-70341416 CAACCCAAATGTCCACCAACTGG + Intronic
1069770368 10:70894872-70894894 CAATCCAGATGTCCATCAACAGG + Intergenic
1070047759 10:72855985-72856007 CAACCCAGATGTTCGTCAACTGG + Intronic
1070225603 10:74501605-74501627 CAACCCAAATGTCCACAAGCAGG + Intronic
1070246396 10:74736183-74736205 CAACCCAAATGTCCACCAACAGG + Intergenic
1071070792 10:81691100-81691122 CAACCCAGCTGTCCTTCAATGGG - Intergenic
1071073378 10:81722680-81722702 CTACCCAAATGTCCATCAACCGG + Intergenic
1071199036 10:83196221-83196243 CAACCAAGATGTCCTTCAATTGG - Intergenic
1071443128 10:85721438-85721460 CAACCCAGATGTCCTCCAATGGG + Intronic
1071506612 10:86235789-86235811 CAACACAAATGTCCATCAACTGG - Intronic
1071678360 10:87679022-87679044 AAACCCAGGTGTCCATCAACAGG + Intronic
1071850203 10:89561085-89561107 CAACCAAGATGTCCTTCAATAGG + Intergenic
1071934460 10:90512379-90512401 CAACCCAGATGTCCATCAACAGG + Intergenic
1072046165 10:91657256-91657278 CAACCCAAATGCCCATCAACAGG - Intergenic
1072335981 10:94398992-94399014 CAACCCAAATGTCCATCATCAGG - Intergenic
1072464643 10:95651969-95651991 CAACCCAGATGTCCTTTAATGGG + Intronic
1072500249 10:96008321-96008343 CAACCTAAATGTCCATCAACAGG - Intronic
1072526345 10:96274973-96274995 TAACCCAGTTGTCCATCAACTGG + Intergenic
1072545847 10:96437799-96437821 CAATCCAGATATCCTTCAACAGG - Intronic
1072712493 10:97725491-97725513 CAACACAAATGTCCATCAACAGG - Intergenic
1072851669 10:98900946-98900968 CAACCCAAATGTCCATCAACAGG + Intronic
1072996682 10:100251119-100251141 CAACCCAAATGTCCATCACCTGG - Intronic
1073576371 10:104629392-104629414 CATCTCAGATGTCCCTCAACAGG + Intergenic
1073601991 10:104854957-104854979 CAACCCAAATGCCCTTCAACAGG - Intronic
1074054551 10:109910669-109910691 CAACCAATATGTCCCTCAGCAGG - Intronic
1074083393 10:110186163-110186185 CAACCCAGATGTCCTTCAACAGG - Intergenic
1074139899 10:110662755-110662777 CAACCCAGATGTCCATCACCAGG + Intronic
1074319708 10:112390622-112390644 CAACCCAGATATTCATCAACTGG + Intronic
1074474730 10:113760258-113760280 CAACCCTGATGTTCATCAACAGG - Intronic
1074518215 10:114191620-114191642 CAACCCAGGTGTCCTTCAATAGG - Intronic
1074576146 10:114671336-114671358 AAACCCAAATGTCCCCAAACAGG - Intronic
1075355536 10:121770092-121770114 CAACTGAGATGTCCTTCAACAGG + Intronic
1075361830 10:121844679-121844701 CAACCAAGATGTCCTTCAATAGG + Intronic
1075431482 10:122385881-122385903 CAACCCAAATGTCCTTCAACTGG - Intronic
1075622751 10:123939809-123939831 CACCCCAGATGTGCCTGATCAGG + Intronic
1075931939 10:126305208-126305230 CAACCCAAATATCCATCAACAGG + Intronic
1076120210 10:127930514-127930536 CAACCCAAATGTCCCCCAACTGG - Intronic
1076178922 10:128390847-128390869 CAATCCAGACGTCCATCAACAGG - Intergenic
1076377265 10:129999878-129999900 CAACCCAGATGTCCTTTAGTGGG + Intergenic
1076389062 10:130083484-130083506 CAACCTAAATGCCCCTACACTGG + Intergenic
1076444602 10:130504113-130504135 CAACCCAGATGTCCTTCAGCAGG - Intergenic
1076913394 10:133403669-133403691 CAACCCACATATCCATCAACGGG - Intronic
1076938896 10:133587127-133587149 CAACCCAAATGTCCACCAACAGG - Intergenic
1077084642 11:742900-742922 CAACCCAAATGTCCATCAGCAGG - Intergenic
1077275601 11:1705905-1705927 CAACCCAGACATCCTTCAACGGG + Intergenic
1078050148 11:7958115-7958137 CAACCAAGATGTCCTTCAATAGG - Intergenic
1078072224 11:8122610-8122632 CAACCCAAATGTTCCTCAACTGG + Intronic
1078557366 11:12340628-12340650 CAACTCAGATATCCATTAACAGG + Intronic
1078625853 11:12957447-12957469 CAACCCAAATGTCCATCAGCTGG - Intergenic
1078792061 11:14553719-14553741 CAACCCAAATGTCCTTCAATGGG - Intronic
1079421807 11:20298701-20298723 TAACCCAAATGTCCATTAACTGG - Intergenic
1079427932 11:20361678-20361700 CAAACCAAATGTCCATCAACAGG + Intergenic
1079624966 11:22606254-22606276 CAACCAAGATGTCCCTCAGCAGG + Intergenic
1079923854 11:26467680-26467702 CAACCCAAGTGTCCATCAACAGG - Intronic
1080223257 11:29931723-29931745 CAATCCAAATGTCCATCAACAGG + Intergenic
1080412062 11:32034996-32035018 CTACCCAAATGTCCATCAACTGG - Intronic
1080432670 11:32213000-32213022 CAAATCAGATGTTCCTAAAGAGG - Intergenic
1081459348 11:43257229-43257251 CAACCAAGATGTCCTTCAAAAGG + Intergenic
1081651900 11:44829579-44829601 CAACCAAGATGTCCTTCAACAGG - Intronic
1082957106 11:58881976-58881998 CAACCCAAATGTCCATGGACTGG - Intronic
1083073668 11:60014498-60014520 CAACCAAGATGTCCTTCAATAGG - Intergenic
1083348145 11:62008443-62008465 CAACCCAAATGCCCATCAACTGG + Intergenic
1083558606 11:63653585-63653607 CAACCAAGATGTCCTTCAACAGG + Intronic
1084434908 11:69133198-69133220 CAACTCAAATGTCCATTAACTGG - Intergenic
1084467073 11:69329967-69329989 CAACTCTGATGTCCGTTAACTGG - Intronic
1085153771 11:74274257-74274279 CAGCCCAGATGTCTGTCAACAGG - Intronic
1085342002 11:75738124-75738146 CAACCAAGATGTCCTTCAATAGG + Intergenic
1085379891 11:76106086-76106108 CAACCCAGATGTCCCTCAACTGG + Intronic
1085540665 11:77266056-77266078 CAACCCAAATGTCCTTTAAGAGG - Intronic
1085589755 11:77748907-77748929 CAACCCAAATGTCCACTAACAGG + Intronic
1085741895 11:79084462-79084484 CAACCCAGATATCCTTCAACAGG + Intronic
1086387190 11:86321324-86321346 CAACCCAAATGTCCATCAGCAGG - Intronic
1086719600 11:90104124-90104146 CAACCCAAATGTCCATCAAGAGG + Intergenic
1086985059 11:93238548-93238570 CAACCTAAATGTCCATCAACAGG - Intergenic
1087564710 11:99839547-99839569 CCACGCAGATGTCCTTAAAAAGG + Intronic
1087611626 11:100441471-100441493 CAACCAAGATGTCCTTCAATAGG + Intergenic
1088163998 11:106909751-106909773 CAACCCAGATTTCCTTAACTGGG - Intronic
1088569464 11:111207811-111207833 CAACCCAAATGTCCATCAACAGG + Intergenic
1088942146 11:114470092-114470114 CAACCCACATGTCCATCAAAAGG - Intergenic
1089114087 11:116080091-116080113 CAACCCAAATGCCCATCAACGGG - Intergenic
1089325476 11:117653799-117653821 CAACCAAAATGTCCATCAACTGG + Intronic
1089761134 11:120724379-120724401 CAACTCAAATGTCCTTTAACTGG - Intronic
1090218816 11:124997123-124997145 CAACCCAGATGTCCATCAATAGG - Intronic
1090241529 11:125185753-125185775 CAACCCACATGTCTATAAACAGG - Intronic
1090449605 11:126794840-126794862 CAACCTAGATGTCCCTCACTGGG + Intronic
1090505962 11:127314350-127314372 CAACCCAAATGTCCTTCAATGGG - Intergenic
1090920522 11:131202517-131202539 CAACCTAAATGTCCATAGACAGG - Intergenic
1091096547 11:132827985-132828007 CAACCAAGATGTCCTTCAATAGG + Intronic
1091135058 11:133180962-133180984 CACCCCAGGTGTCCTTCAACAGG + Intronic
1091338383 11:134791567-134791589 CAACCCAAATATCCATAAACTGG + Intergenic
1091468457 12:706004-706026 CAACCCAAATGTCCATCAATAGG - Intergenic
1091532056 12:1367732-1367754 GAATCAAGATGTCCCTAAAAGGG - Intronic
1091541007 12:1462421-1462443 CAACCCAAATGTCCATTAACAGG + Intronic
1091579941 12:1779263-1779285 CAACCCAGATGTCTATCGACTGG + Intronic
1091716709 12:2782793-2782815 CAACCCAAATGCCCATCAACGGG + Intergenic
1092177209 12:6418296-6418318 CAACCCAAATGTCCATCAACAGG + Intergenic
1092235690 12:6807322-6807344 CAATCTAGATGTCCTTCAACTGG + Intronic
1092521726 12:9282378-9282400 CAACTCAAATGTCCCACAACAGG + Intergenic
1092699479 12:11211812-11211834 CAATCAAGATGTCCTTCAACAGG + Intergenic
1093012429 12:14123065-14123087 CAACCCAGATGGCCTTTAATAGG + Intergenic
1093190337 12:16067109-16067131 TAACCCACATGTCCATCAACAGG - Intergenic
1094087974 12:26614561-26614583 CAACCAAGATGTCCTTCAATAGG + Intronic
1094128330 12:27047260-27047282 CAACCCAAATGTCTGTCAACAGG - Intronic
1094312629 12:29101546-29101568 CAACCAAGATGTCCTTTAACAGG - Intergenic
1094780038 12:33780466-33780488 CAACCCAGATGTCCTTCAGTAGG - Intergenic
1095116392 12:38358046-38358068 CAACCAAGATGTCCTTACATAGG + Intergenic
1095166037 12:38973164-38973186 CAACCAAGATGTCCTTCAATAGG - Intergenic
1095324781 12:40875758-40875780 CAATCCAGATATCCTTCAACAGG - Intronic
1095413610 12:41950684-41950706 CAGCCCAGATGTCCATCAACAGG + Intergenic
1095443663 12:42263344-42263366 CAACCCAGATGTCCTTATACTGG - Intronic
1095999520 12:48117230-48117252 CAACCAAGATGTCCCTCAAAAGG - Intronic
1096285275 12:50294371-50294393 CAACCCAAATGTCCATCAACTGG - Intergenic
1096703129 12:53400410-53400432 CAACCCAAATGTCCATCAACTGG - Intronic
1096902125 12:54895040-54895062 CAACCGAGATGTCCTTCAATAGG + Intergenic
1097052210 12:56230375-56230397 GGACCCAGGTGTCCCTAACCTGG - Intronic
1097126122 12:56776885-56776907 CAACCAAGATGTCCTTCAATAGG - Intronic
1097213475 12:57391180-57391202 CAACACAGAAGTCCTTCAACAGG + Intronic
1097553896 12:61113643-61113665 CAACTCAGATGTCCTTCAATAGG + Intergenic
1097862340 12:64530468-64530490 CAACTCAAATGTCCATCAACAGG - Intergenic
1097917952 12:65039893-65039915 CAACCCAATTGTCCATCAACAGG - Intergenic
1098913981 12:76238635-76238657 CAGCCCAGATGTCTTTCAACAGG - Intergenic
1098989878 12:77053667-77053689 CAACCCAAATGGCTATAAACAGG + Intronic
1099416716 12:82396996-82397018 CAACTCAAATGTCCATCAACTGG - Intronic
1099821213 12:87712918-87712940 CAACCAAGATGTCCTTCAATAGG + Intergenic
1100208016 12:92372347-92372369 CAACCCAAATGTCCATCAACAGG - Intergenic
1100322648 12:93510338-93510360 CAACCAAGATGTCCTTCAGCAGG - Exonic
1100324025 12:93524117-93524139 CAACCCAAATGTCAATCAACAGG - Intergenic
1100327801 12:93555834-93555856 CAGCCCAAATGTCCATCAACAGG - Intergenic
1100571888 12:95850767-95850789 CAACCCAAATGTCCATTAACAGG + Intergenic
1100915516 12:99416251-99416273 CAACCCAGATGTCCTTCATTGGG - Intronic
1100949298 12:99828034-99828056 CAACCCAAATGTCCATTAGCTGG + Intronic
1101112291 12:101497740-101497762 CAACCCACATGTACATCAACTGG - Intergenic
1101192088 12:102344943-102344965 CAACCCAAATGTCCATCAGCAGG - Intergenic
1101246961 12:102892531-102892553 CAACCAAGATGTCCTTCAATAGG + Intronic
1101257713 12:102995682-102995704 CAACCCAAATGTCCTTCAACAGG - Intergenic
1101635444 12:106536748-106536770 CAACCAAGATGTCCTTCAATAGG + Intronic
1101877423 12:108605089-108605111 CAGCCCAAATGTCCATCAACAGG + Intergenic
1102191089 12:110988847-110988869 CAGCCCAGGTGTCCATCAACGGG + Intergenic
1102205471 12:111087895-111087917 CACCCCAGATGTCCTTCACCAGG + Intronic
1102220290 12:111189592-111189614 CAACCCAAATGCCCATTAACAGG - Intronic
1102403111 12:112648324-112648346 CAACCTAAATGTCCATTAACTGG - Intronic
1102408863 12:112699373-112699395 CAACACAGATGTCTGTCAACAGG + Intronic
1102549466 12:113681014-113681036 CTACCCAGATGTCCAGCAACAGG + Intergenic
1102855714 12:116291490-116291512 CAACCCTAATGTCCTTCAACTGG - Intergenic
1102876157 12:116450645-116450667 CAGCCCAAATGTCCCTCAGCTGG - Intergenic
1103484238 12:121272270-121272292 CAATCCAAATGTCCTTCAACAGG + Intronic
1103889783 12:124229593-124229615 CAACTCAGATGTCCATCAATGGG - Intronic
1103965352 12:124635597-124635619 CAACCCAGATGTCTATCAACAGG - Intergenic
1104135890 12:125938165-125938187 CTACCCAGATGTCCTTTAATGGG - Intergenic
1105052962 12:133071181-133071203 CAACCCAAATGTCCACCAACAGG - Intergenic
1105060650 12:133147150-133147172 AAACTCAAATGTCCCTCAACAGG - Intronic
1105343705 13:19553543-19553565 CAACCCAAATGTCCACTAACAGG + Intergenic
1105536339 13:21268091-21268113 CAACCCAAATGTCCACTAACAGG - Intergenic
1105664347 13:22535624-22535646 CAAGCCAAATGTCCATCAACTGG + Intergenic
1105766398 13:23564289-23564311 CAACCAAGATGTCCTTCAATAGG + Intergenic
1105776974 13:23671673-23671695 CAACCCACATTTCCCCCAACAGG + Intronic
1105822365 13:24090948-24090970 CAGACCAGAAGTCACTAAACAGG - Intronic
1105929436 13:25038651-25038673 CAACCCAAATTTCCATCAACAGG + Intergenic
1106128199 13:26918342-26918364 CTACCTAGATGTCCTTCAACAGG - Intergenic
1106214860 13:27687495-27687517 CAACCCAAATGTCCATCAAGAGG + Intergenic
1106589094 13:31083901-31083923 CAACCCAGATGTCCATCAACTGG + Intergenic
1106985400 13:35341957-35341979 CAACCCAAATGTTCATCAACTGG + Intronic
1107098079 13:36558281-36558303 CAACCCAAATTTCCATCAACAGG - Intergenic
1107477248 13:40750117-40750139 CAACCCAAATGTCCACTAACAGG + Intronic
1107767426 13:43751778-43751800 TAACCCACATGTCCATCAACAGG - Intronic
1107839856 13:44446103-44446125 CAAACCAAATGTCACTCAACTGG + Intronic
1107866590 13:44709195-44709217 CAGCCTAGATGTCCTTCAACTGG - Intergenic
1108269232 13:48742463-48742485 CAACCCACATGTCCTTCAATGGG - Intergenic
1108387643 13:49915786-49915808 CAACCCTAATGTCCATCAACTGG + Intronic
1108697136 13:52912468-52912490 CAACCAACATCTCCCTCAACTGG - Intergenic
1110185597 13:72671342-72671364 CAACCCAAATGTCCCCCAACAGG + Intergenic
1110802863 13:79720402-79720424 CAACACAGATGTCTATCAACAGG - Intergenic
1110973395 13:81796604-81796626 CAACCAAGATGTTTTTAAACAGG - Intergenic
1111227914 13:85299559-85299581 CAACTCAAATGTCCCTAGATAGG - Intergenic
1111263068 13:85768764-85768786 CAACCAAGATGTTCTTAAATAGG - Intergenic
1111511117 13:89264077-89264099 CAACCAAGATGTCTTTCAACAGG - Intergenic
1112404502 13:99107043-99107065 CAACCTAAATGTCCATCAACTGG + Intergenic
1112472859 13:99705189-99705211 CAACCCAGGTGTCCATCGACAGG + Intronic
1112524593 13:100132558-100132580 CAACCCAAATGTCCTTCAACAGG - Intronic
1112527440 13:100165069-100165091 CAGCCCAAATGTCCATCAACAGG - Intronic
1112714950 13:102173572-102173594 CAACCCAAATGTCCATCAACGGG + Intronic
1113196621 13:107815730-107815752 CAACCCCAATGTCCATCAACTGG + Intronic
1113239734 13:108323730-108323752 CAACCAAGATGTCCTTCAACAGG - Intergenic
1113434819 13:110282745-110282767 CAACACAGGTGCCCCAAAACAGG - Intronic
1113461864 13:110487549-110487571 CAGCCCAAATGTCCATCAACAGG + Intronic
1113502197 13:110785214-110785236 CAACCCAAATGCCCATTAACTGG + Intergenic
1113741491 13:112715146-112715168 CAACCCAAGTGTCCTTCAACAGG - Intronic
1113798156 13:113070830-113070852 CAACCCAGATACCCTTCAACAGG - Intronic
1113829374 13:113283095-113283117 CAACCCAAATGTCCTTCAACAGG + Intergenic
1114370946 14:22087435-22087457 CAACCCAAATGTCCATTAGCTGG + Intergenic
1114372404 14:22104586-22104608 CAACCCAAATGTCCATCAGCTGG - Intergenic
1114389507 14:22291783-22291805 CAACCAAGATGTCCTTCAACAGG + Intergenic
1114719734 14:24868505-24868527 CAACCCAAATGTCCCTCAGCAGG + Intronic
1115856747 14:37638076-37638098 CAACCCAGATGTCCTTCAAGGGG + Intronic
1116506128 14:45683952-45683974 CAACCTAGGTGTCCATCAACAGG - Intergenic
1117303232 14:54448717-54448739 TAGCCCAGATGTCCATAAATAGG - Intergenic
1117453198 14:55872356-55872378 CAACCCAAATGTCCTTCAATGGG - Intergenic
1117459325 14:55929126-55929148 CACCCCAAATGTCCATCAACAGG - Intergenic
1118035606 14:61863018-61863040 CAACCAAGATGTCCCTCAATAGG - Intergenic
1118168777 14:63364208-63364230 CAACCCAGACTTCCTTTAACTGG + Intergenic
1118301532 14:64621083-64621105 CAACCCAAATGTCTATCAACAGG + Intergenic
1118576302 14:67244601-67244623 CAACTCAAATGTCCTTCAACTGG - Intronic
1118840606 14:69507406-69507428 CAACCAAGATGTCCTTAAGTAGG - Intronic
1118891322 14:69911750-69911772 CAACCCAAATGTCCTTCATCTGG - Intronic
1119050590 14:71364586-71364608 CAACCCAAATATCCTTTAACTGG - Intronic
1119209431 14:72819442-72819464 CAACCCAAATGTCCATCAACTGG + Intronic
1119257983 14:73216042-73216064 CAATCCAGATGTCCATCAACTGG + Intronic
1119278075 14:73378494-73378516 CAACCAAGATGTCCTTCAGCAGG + Intronic
1119297024 14:73541260-73541282 CAACCCAAATGTCCTTTAACTGG - Intronic
1119301263 14:73573163-73573185 CAACCCAAATGTCCTTTAACTGG - Intronic
1119550638 14:75510946-75510968 CAAACCAGATGTTCATCAACTGG + Intergenic
1119795906 14:77397140-77397162 CAACCCAGATGTCCTTCAACAGG + Intronic
1120452780 14:84691087-84691109 CAACCCTGATGTCCTTCAGCAGG - Intergenic
1120977479 14:90261897-90261919 CAACCCAAATGTCCATTAATAGG + Intronic
1121284328 14:92723458-92723480 CAACCCAAATGTCCATCAACTGG + Intronic
1121296639 14:92831343-92831365 CAACCCAAATGTCCATCAGCAGG + Intronic
1121616527 14:95317466-95317488 CAACCCAAAGGTCCCTCAACAGG + Intronic
1121905310 14:97736151-97736173 CAACTCAAATGTCCATCAACAGG - Intergenic
1122376132 14:101259683-101259705 CAACCCAAATGTCCATCAACAGG - Intergenic
1122449196 14:101790627-101790649 CAGCCCAAATGTCCATTAACTGG - Intronic
1122450818 14:101805648-101805670 CAACCCAAATGTCCGTAAACAGG + Intronic
1122533403 14:102445088-102445110 TAGCACAGATGGCCCTAAACAGG + Intronic
1122780002 14:104139537-104139559 CAGCCCAGATGTCCCACAGCTGG + Intronic
1122815837 14:104313473-104313495 CAACCCAGATGTCCTTCGATGGG + Intergenic
1122851415 14:104534116-104534138 CAACCAAGATGTCCTTCAATAGG - Intronic
1123652537 15:22488596-22488618 CAACCTAAATGTCCATCAACAGG - Intergenic
1123742959 15:23297455-23297477 CAACCTAAATGTCCATCAACAGG - Intergenic
1123972274 15:25518834-25518856 CAGCTCAGATGTCCTTCAACAGG + Intergenic
1124071590 15:26398440-26398462 CAACCAAGATGTCCTTCAATAGG - Intergenic
1124084946 15:26540054-26540076 CAACCCAAATGTCTATCAACAGG + Intergenic
1124276301 15:28328420-28328442 CAACCTAAATGTCCATCAACAGG + Intergenic
1124306397 15:28583187-28583209 CAACCTAAATGTCCATCAACAGG - Intergenic
1124433226 15:29625267-29625289 CAACCCAAATGTCCTTCAAAGGG - Intergenic
1124442696 15:29699213-29699235 CAACCCAGAAGTTCCTTAACTGG + Intergenic
1124462500 15:29905603-29905625 TAACCAAGATGTCCTCAAACAGG + Intronic
1124574209 15:30893692-30893714 CAACCCAAATGTCCTTCAGCAGG - Intergenic
1124580446 15:30949711-30949733 CAACCCAAATGTCCATCAACAGG + Intronic
1124585923 15:31006511-31006533 CAACCCAAATGTCCTTCAACAGG - Intronic
1125253108 15:37729294-37729316 CAACCTAGATGTCCAATAACAGG - Intergenic
1125638838 15:41212683-41212705 CAACCCAAATGTCCATCAAATGG + Intronic
1125987532 15:44069420-44069442 CAATCCAGATGTACTTCAACAGG + Intronic
1126262192 15:46706235-46706257 CAACCCAGATGACCTTTAACAGG + Intergenic
1126399358 15:48253590-48253612 CAACTCAGATGACCATCAACTGG - Intronic
1126502513 15:49361641-49361663 CAACCTAGATGCCCATCAACAGG - Intronic
1126606659 15:50484734-50484756 CAACCCAAATGTCCATCAGCAGG + Intronic
1126611204 15:50531309-50531331 CAACCCAAACGTCCATCAACTGG + Intronic
1127227696 15:56950680-56950702 CAACCCAAATGTCCATTAACAGG - Intronic
1127407762 15:58669719-58669741 CAACCAAAATGTCCATTAACAGG + Intronic
1127829217 15:62735825-62735847 CAACCCAAAAGTCCATCAACAGG + Intronic
1128190017 15:65684119-65684141 CAACCCAAATTTCCGTCAACTGG - Intronic
1128201192 15:65809518-65809540 TAGCCCAGATGTCCCTCAACTGG - Intronic
1128207024 15:65861936-65861958 AAGCCCAAATGTCCATAAACAGG - Intronic
1128438043 15:67675191-67675213 CAACTCAGATGTCCTTCAACAGG + Intronic
1128534093 15:68477608-68477630 CAATCCAGATGTCCTTTAACAGG + Intergenic
1128574664 15:68764437-68764459 CAACCCAGATGTCCTTCAATGGG + Intergenic
1128884205 15:71271215-71271237 CAACCCAAATATCCATCAACAGG + Intronic
1129062984 15:72875292-72875314 CAACCCAAATGTCCATCAACAGG - Intergenic
1129136669 15:73558891-73558913 AAACCCAAATGTCCTTCAACTGG + Intronic
1129993106 15:79981732-79981754 CAACCCAAATGTTCATCAACAGG - Intergenic
1130010046 15:80144854-80144876 CAACCAAGATGTCCTTCAATAGG + Intergenic
1130041567 15:80409475-80409497 CAACCCAGATGTCCTTCAGTAGG - Intronic
1130249442 15:82288075-82288097 CAACCCAGATGTCTTTCCACTGG + Intergenic
1130362428 15:83202904-83202926 CAACCCAAATGTCCATCAGCAGG - Intronic
1130831015 15:87599656-87599678 CAACCCAGATGTCCTTCAAAAGG - Intergenic
1130961487 15:88662043-88662065 CAACCCAGACGTCCTTCAATGGG + Intergenic
1130971303 15:88735625-88735647 CAACTCAAATGCCCCTCAACAGG - Intergenic
1131101724 15:89696382-89696404 CAATCCAAATGTCCTTCAACAGG - Intronic
1131500373 15:92958035-92958057 CAATCCAAATGTCCATCAACCGG - Intronic
1131528140 15:93168505-93168527 CAACCCAGATGTCCTTCAGCTGG - Intergenic
1131561439 15:93446468-93446490 CAACCCAAATGTCCATCAACTGG + Intergenic
1131641016 15:94293960-94293982 CAACCCAAATGTCCTTCAAGGGG + Intronic
1131728620 15:95254803-95254825 CAATCCAGATGTCCTTCAAGGGG - Intergenic
1131776194 15:95801625-95801647 GAACCCAAATGTCCGTCAACAGG - Intergenic
1133514419 16:6494582-6494604 CAACCCAGATATCCTTCAACAGG - Intronic
1133736478 16:8619785-8619807 CAGCCCAGATGGCCCCAAAAGGG - Intergenic
1133982126 16:10640873-10640895 CAACCCACATGTCCATGAACAGG - Intronic
1134009056 16:10837778-10837800 CAACCAAGATGTCCCTCGGCAGG + Intergenic
1134048267 16:11117796-11117818 CAACCTAAATGTCCCCAAACAGG - Intronic
1134078093 16:11306394-11306416 CAACCCAGATGCCCATTAATGGG + Intronic
1134357327 16:13494854-13494876 CAACCCAAATGTCCTTTAATAGG + Intergenic
1134389124 16:13802668-13802690 CAACCCAGATGTCCATCAGTAGG + Intergenic
1134425494 16:14139727-14139749 CAACCCAGATGTCCATCAGTAGG + Intronic
1134463750 16:14453811-14453833 CAGCCCAAATGTCCATCAACTGG - Intronic
1134563299 16:15229229-15229251 CAACCCAAATGTCCATCAATAGG + Intergenic
1134605323 16:15566445-15566467 CAACCCAGATGTCTATGAATAGG + Intronic
1134820719 16:17244755-17244777 CAACCTAAATGTCCCTCAATAGG + Intronic
1134903122 16:17956513-17956535 CAACCCAGATGTCCATCAACTGG + Intergenic
1134923826 16:18140858-18140880 CAACCCAAATGTCCATCAATAGG + Intergenic
1135036847 16:19085923-19085945 CAACCCAGATGTCCACCAAGAGG - Intergenic
1135477717 16:22792179-22792201 CAACCCAAATGTCCCTCAATGGG + Intergenic
1135781597 16:25307598-25307620 CAGCGCAGATGTCCTTCAACAGG + Intergenic
1135834609 16:25813825-25813847 CAACCCAAATGTCCATTATCGGG + Intronic
1136287030 16:29250459-29250481 CAACCCAGGTGTCCCCTAATAGG + Intergenic
1136994539 16:35180948-35180970 TAAACCAGATGTCCCCCAACAGG - Intergenic
1137306205 16:47203090-47203112 CAACCCAAGTGTCCATGAACTGG + Intronic
1137371295 16:47908359-47908381 CAACCCAAATGTCCATCAACAGG - Intergenic
1137477515 16:48822504-48822526 CAACTCAAATGCCCCTCAACTGG - Intergenic
1137946696 16:52739690-52739712 CAACCAAAATGTCCATCAACAGG + Intergenic
1137984443 16:53095738-53095760 CAACCCAAATGTCCACTAACAGG - Intronic
1138014509 16:53416544-53416566 AAACCCAAATGTCCTTCAACAGG + Intergenic
1138356078 16:56381445-56381467 CAACCAAGATGTCCTTAAGTAGG + Intronic
1138639501 16:58372393-58372415 CAACCTAGATGTCCTTCAACAGG - Intronic
1138725765 16:59137273-59137295 CAACCAAGATGTCTTTCAACAGG - Intergenic
1138769121 16:59641184-59641206 TAACCCAGATATCCTTCAACAGG - Intergenic
1139090235 16:63637327-63637349 CAACCAAAATGCCCCTCAACAGG + Intergenic
1139189881 16:64849965-64849987 CAACCAAGATGTCCTTTAATGGG + Intergenic
1139498126 16:67336237-67336259 CAACCAAGATGTCCTTCAATAGG - Intronic
1140130509 16:72156708-72156730 CAACCCAAATATCCATCAACTGG - Intronic
1140636058 16:76915197-76915219 TAGCCCAGATGTCCATCAACTGG + Intergenic
1141022595 16:80511459-80511481 CAACCTAGATGTACATGAACAGG + Intergenic
1141076736 16:81013121-81013143 CAACCCAAATGTCCATCAGCAGG + Intronic
1141931433 16:87207086-87207108 GAACCCAAATGTCCTTCAACTGG + Intronic
1141966411 16:87447603-87447625 CAACCCAGATGTCCATGAGTAGG - Intronic
1142092634 16:88223091-88223113 CAACCCAGGTGTCCCCTAATAGG + Intergenic
1142502814 17:342449-342471 CAACTCAAATGTCCATCAACTGG + Intronic
1142503515 17:347787-347809 CAACCAAGATGTCCTTCATCAGG + Intronic
1142776977 17:2148350-2148372 CAACCCAAGTGTCCATCAACAGG + Intronic
1142822185 17:2478869-2478891 CAACCCAGATGTTCAGGAACTGG - Intronic
1142998900 17:3778147-3778169 CAACCCAAATGTCCATCAACAGG + Intronic
1143263553 17:5618761-5618783 CAACCCAAATGTCCATCAACAGG - Intronic
1143383911 17:6514844-6514866 CAACTCACATGTCCATCAACTGG + Intronic
1143572328 17:7767335-7767357 CAACCCAAATGTCCATCAACTGG - Intronic
1143643709 17:8215650-8215672 CAGCCCAAATGTCCATCAACTGG + Intergenic
1143943748 17:10570862-10570884 CAACCCAAATGTCTGTCAACAGG - Intergenic
1144231983 17:13216529-13216551 CAACCAAGATGTCCTTCAATAGG + Intergenic
1144373511 17:14616138-14616160 CAACCAAGATGTCCTTCAACAGG - Intergenic
1145848497 17:28066514-28066536 CAACCTAAATGTCCATCAACAGG - Intronic
1146200052 17:30849229-30849251 CAATCCAGATGTCCATTAATAGG - Intronic
1146238557 17:31191374-31191396 CAGCCCAAATGTCCCTCAGCTGG + Intronic
1146752268 17:35392061-35392083 CAATCAAGATGTCCCTCAATAGG - Intergenic
1147001853 17:37369032-37369054 CAACACAAATGTCTCTCAACAGG + Intronic
1147222819 17:38949063-38949085 CAACTCAGATGTCCATCAATGGG - Intronic
1147431461 17:40373675-40373697 CAGCCCAGATGTCCATCAACAGG + Intergenic
1147516856 17:41126533-41126555 CAACCCAGGTGTCCTTCAATAGG + Intergenic
1148004497 17:44414973-44414995 TAACCCACATGTCCATCAACTGG - Intronic
1148163619 17:45466977-45466999 CAACCCAAATGTCCATTAACAGG + Intronic
1148345266 17:46899006-46899028 CAACCCAAATGTCCATCCACTGG + Intergenic
1148430476 17:47639057-47639079 TAATCCAAATGTCCATAAACAGG + Intergenic
1148453058 17:47793287-47793309 TAATCCAAATGTCCCTCAACTGG + Intergenic
1148532610 17:48409293-48409315 CAACCAAAATGTCCCTCAATAGG + Intronic
1148641007 17:49187490-49187512 CAACCCAAATGTCCATCAACTGG + Intergenic
1148904567 17:50904096-50904118 CAACCCAGATGTCCAAACACAGG + Intergenic
1148976161 17:51530880-51530902 CAACCCAAATGTCCATCAACTGG - Intergenic
1149409353 17:56389153-56389175 TAATCCAGATGTCCTTAAATTGG + Intronic
1149447419 17:56724394-56724416 AAACCCAGTTGACCCAAAACAGG + Intergenic
1149625404 17:58076724-58076746 CAACCCAAATGTCCATCAACTGG + Intergenic
1149782808 17:59411461-59411483 CAAAACAAATGTCCCTCAACTGG - Intergenic
1150191287 17:63242728-63242750 CATCCCAGATGCCCATCAACAGG + Intronic
1150306068 17:64086515-64086537 CAACTCAAATGTCCCTCAGCAGG - Intronic
1150317625 17:64182869-64182891 CAACCCATATTTCCATTAACTGG - Intronic
1150394848 17:64813630-64813652 CAACCCAAATGTCCATTAACGGG + Intergenic
1150481113 17:65511974-65511996 CAACCCAAATGTCCATCAACAGG + Intergenic
1150496167 17:65609462-65609484 CCAGCCAGATGTCCCCACACTGG - Intronic
1150548193 17:66184831-66184853 CAGCCCAAATGTCCCTCAAATGG + Intronic
1150704014 17:67471357-67471379 TAACCCAAATGTCCATCAACTGG - Intronic
1150749873 17:67850776-67850798 CAACCAAAATGTCCATCAACAGG - Intronic
1151263399 17:72935110-72935132 CAACACAAATGTCCTTCAACTGG + Intronic
1151277194 17:73044288-73044310 TAACCCAAATGTCCATCAACAGG + Intronic
1151374555 17:73677607-73677629 CGACGCAGATGTCCATCAACAGG + Intergenic
1151764632 17:76126037-76126059 CAACCCAGATATCCATCAAGAGG + Intergenic
1152054366 17:78011583-78011605 AAACGCAGATGTCCATGAACAGG - Intronic
1152093681 17:78260517-78260539 AATCCCAAATGTCCCTAAACAGG - Intergenic
1152314024 17:79569477-79569499 CAGCCCAAATGTCCGTCAACAGG - Intergenic
1152321711 17:79611552-79611574 CAACCCAGGTGACCCTTAACAGG + Intergenic
1153045472 18:851923-851945 CAATCCAAATGTCCATCAACTGG + Intergenic
1153269901 18:3310179-3310201 CAACCCAAGTGTCCATCAACAGG + Intergenic
1153374003 18:4355220-4355242 CAGTCCAGGTGTCCCTGAACAGG + Intronic
1153532399 18:6060904-6060926 CAACCAAGATGTCCTTCAATAGG - Intronic
1153629058 18:7052015-7052037 CAACCAAGATGTCCTTTAATAGG + Intronic
1153645437 18:7192026-7192048 CAAGCCAAATGTCCATCAACAGG - Intergenic
1153884425 18:9450783-9450805 CAACACAAATGTCCATCAACTGG + Intergenic
1154232827 18:12573542-12573564 CAACCAAGATGTCCCTCAATAGG + Intronic
1154275239 18:12953262-12953284 CAACTCAAATGTCCGTCAACTGG - Intronic
1154337835 18:13480156-13480178 CAACCCAGATGTCCTTCAGTAGG + Intronic
1155031399 18:21987984-21988006 CAACCCAGATGTCCTTCAACAGG + Intergenic
1155466877 18:26145757-26145779 TAACCCAAATGTCCCTCAATAGG - Intronic
1155862147 18:30915497-30915519 CAATCCAAATGTCCTTCAACAGG + Intergenic
1156024651 18:32638175-32638197 CAACCCAGTTACCACTAAACAGG + Intergenic
1156210900 18:34941370-34941392 CAACCTAAATGTCCATCAACTGG + Intergenic
1156413606 18:36862604-36862626 CAACACAAATGTCCTTCAACAGG - Intronic
1156435871 18:37128743-37128765 CAAGCCAAATGTCCATCAACTGG + Intronic
1156469859 18:37370445-37370467 GAACCCAGATGTCTCTACAAGGG + Intronic
1156665272 18:39397617-39397639 CAATCCAAATGTCCATCAACAGG + Intergenic
1156832553 18:41511850-41511872 CAACCCAAATATCCATCAACAGG + Intergenic
1157352711 18:46903809-46903831 CAACCCAGATGTCCCTCAACAGG + Intronic
1157388116 18:47277226-47277248 CAATCAAGATGTCCCTGAATAGG - Intergenic
1157759340 18:50248880-50248902 CAACTCAAATGTCCTTCAACAGG + Intronic
1158087134 18:53664726-53664748 CAACCCAGTTGTCTATCAACTGG + Intergenic
1158247717 18:55451001-55451023 CAACACAGCTGTCCCCAAAGAGG + Intronic
1158261802 18:55613892-55613914 CAACCCAAATGACCATTAACAGG - Intronic
1158343672 18:56492848-56492870 CAATCCAGATGTCCATCAACAGG - Intergenic
1158370839 18:56801848-56801870 CAACCCAGATGTCCCTAAACAGG - Intronic
1158380534 18:56925175-56925197 CAACCCAAATGTCCATCAACAGG - Intronic
1158512752 18:58106151-58106173 CAGCACGGATGTCCCTACACAGG - Intronic
1158974478 18:62698727-62698749 CAACCCAAATGCCCATGAACAGG - Intergenic
1158987512 18:62833785-62833807 CAACCCAAATGTCCATCAGCAGG - Intronic
1159068754 18:63598656-63598678 CAATCCAAATGTCCCTCAACTGG - Exonic
1159453510 18:68632347-68632369 CAACCCAGATTTCCTTCAACTGG + Intergenic
1159930256 18:74304766-74304788 CAACCAAAATGTCCCTCAATAGG - Intergenic
1159941014 18:74408592-74408614 CAACTCACATTTCCCTAAAATGG + Intergenic
1160083004 18:75747730-75747752 CAATCCAGATGTCCCTCAATGGG - Intergenic
1160087643 18:75792660-75792682 CAACCCAGATTTCTATAACCAGG + Intergenic
1160115865 18:76078756-76078778 CAACCCAAATGTCCATCATCAGG - Intergenic
1160246537 18:77164378-77164400 CAACCCACATGTCTCCCAACAGG + Intergenic
1160555785 18:79723994-79724016 CAACCCAAATATCCCTCAAAGGG - Intronic
1161248176 19:3266554-3266576 CAACCCAAGTGTCCCCCAACAGG - Intronic
1161553244 19:4926206-4926228 CAACCCAGGTGTCCATCAACAGG - Intronic
1161639923 19:5415650-5415672 CAACCTAAATGGCCCTCAACAGG - Intergenic
1161773813 19:6246377-6246399 CAACACAGACGTCCTTCAACAGG + Intronic
1162015016 19:7840864-7840886 CAATCCACATGTCCATCAACGGG - Intronic
1162437545 19:10671287-10671309 CAACCCAGAGGTCCCCAGAGAGG - Intronic
1162819536 19:13214198-13214220 CAGCCCAGATGTCCCCAGAGCGG + Intronic
1163181064 19:15602412-15602434 CAACCTAAATGTCCATCAACTGG - Intergenic
1163903266 19:20126657-20126679 CAACCTAGATGTCCATCAATAGG - Intronic
1164420323 19:28086039-28086061 CAACCCATATGTCCTTCAATAGG + Intergenic
1164493786 19:28738811-28738833 CAACCCAGACGTCCTTCAATAGG + Intergenic
1164961561 19:32435356-32435378 CAACCCAGATGTTCCTCAATAGG - Intronic
1164980404 19:32609416-32609438 CTACTCAGATGTCCATTAACAGG + Intronic
1165437411 19:35803741-35803763 CAGCCCAAATGTCCATAAATGGG + Intronic
1165896954 19:39147396-39147418 AAACCCAGATGTCCTCCAACGGG - Intronic
1166155284 19:40906712-40906734 CAACCAAGATGTCCTTTAACAGG - Intergenic
1166188050 19:41154983-41155005 CAGCTCAGATGTCCATCAACAGG + Intergenic
1166350144 19:42193853-42193875 CAACCCAAATGTCCATCAAAAGG + Intronic
1168123556 19:54269909-54269931 CAACCCAAATGTCCATCAATTGG + Intronic
1168413143 19:56152447-56152469 CAACCCAAATGTCCTTCAACAGG - Intronic
1168446250 19:56417091-56417113 CAACCCAAATGTCCATCACCAGG - Intronic
924995537 2:357276-357298 CAAACAAAATGTCCCTAAAAAGG - Intergenic
925253177 2:2459716-2459738 CAACCAAGATGTCCTTCAGCAGG + Intergenic
925543963 2:4998839-4998861 CAACCAAGATGTCCTTCAATAGG + Intergenic
925550644 2:5070362-5070384 CAACCTAGATGTCCTTATACAGG + Intergenic
925552881 2:5095134-5095156 TAACTCAGATGTCCATCAACAGG + Intergenic
926040875 2:9672105-9672127 CATCCCAGATGTCCTTTAATAGG - Intergenic
926212560 2:10881793-10881815 CAGCCCAGATGTCCTTCAGCAGG - Intergenic
926651167 2:15347391-15347413 CAACCCAAATGTCCACCAACTGG + Intronic
926678517 2:15646839-15646861 CAACCCACATGTCCATTAATGGG + Intergenic
926761540 2:16282794-16282816 AAACCCAACTGTCCCCAAACAGG + Intergenic
926835660 2:17016639-17016661 CAACCCACATGTCTATCAACTGG - Intergenic
926845132 2:17128308-17128330 CAGCCCAGATGTCCTTCAACTGG - Intergenic
926935892 2:18086328-18086350 AATCCCAGATATCCCTAAAGTGG - Intronic
927273173 2:21236196-21236218 CAACCCACATGCCCATAAACAGG - Intergenic
927527864 2:23764003-23764025 CAACCCAGATGTCTGTCAGCTGG - Intronic
927567550 2:24126066-24126088 CAACCCAAATGTCCATAAACAGG - Intronic
927740234 2:25562326-25562348 TAACCCAAATGTCCATCAACTGG - Intronic
927839000 2:26425319-26425341 CAACCCAAATGTCCATTCACAGG - Intronic
928068529 2:28191484-28191506 CAACCCAAATGTCCATCAACAGG + Intronic
928269021 2:29838516-29838538 TAATCCAGATGTCCATCAACAGG + Intronic
928365418 2:30696857-30696879 CAACCCAGCTGTCCCTCAGCTGG - Intergenic
929012805 2:37462288-37462310 CAACCCAAATGTCTATCAACTGG - Intergenic
929143481 2:38686616-38686638 CAACCCAGAAGTCTATCAACAGG + Intronic
929182100 2:39052690-39052712 CAACCCAAATGTCCATCAGCAGG - Intronic
929213495 2:39385110-39385132 CAACCCAGATACCCTTCAACTGG - Intronic
929236811 2:39614022-39614044 CAACCAAGATGTCCTTCAATAGG - Intergenic
929319367 2:40523016-40523038 CAACTCAGATGTTCTTCAACAGG - Intronic
929561305 2:42958110-42958132 GAATCCATATGTCCCTAAGCTGG - Intergenic
929567151 2:42995969-42995991 CAACCCAAATGTCCATCAACCGG - Intergenic
929623288 2:43379784-43379806 CAATCAAGATGTCCTTCAACAGG + Intronic
929949006 2:46392127-46392149 CAACCCAAATGTCCTTCGACAGG + Intergenic
929985117 2:46722577-46722599 TAACCCATATGTCCTTCAACAGG - Intronic
930147087 2:48018440-48018462 CAACCCAAATGTCCGTCACCTGG - Intergenic
930425705 2:51209923-51209945 CAACCTAAATGTCCATCAACAGG + Intergenic
930466819 2:51763787-51763809 CAACCCAGATGCTCTTCAACTGG + Intergenic
930922458 2:56773413-56773435 CAACCCAGCAATCCCTACACTGG - Intergenic
931024347 2:58092411-58092433 CAACCCAGATAGCCATCAACAGG - Intronic
931215402 2:60237550-60237572 CAACTCAGCTGTCCATCAACAGG - Intergenic
931424634 2:62159514-62159536 CAGCCCAGATGTCCTTCCACAGG + Intergenic
931489644 2:62730544-62730566 CAACTAAGATGTCCTTCAACAGG - Intronic
931564868 2:63605360-63605382 CAAACCAGATGTCCCTGACGTGG - Exonic
931703799 2:64930015-64930037 CAAGCCAACTGTCCCTTAACAGG - Intergenic
931738277 2:65218317-65218339 CAACCCAAATGTCCATTACCTGG - Intergenic
931816428 2:65907475-65907497 CAACTCAAATGTCCATCAACTGG + Intergenic
932022365 2:68100150-68100172 CAACCCAAAGGTCCATCAACTGG + Intronic
932042301 2:68313421-68313443 CAACCCAGATGTCCATTTATTGG + Intronic
932166866 2:69515885-69515907 CAACCCAAATGTCTATCAACAGG + Intronic
932530644 2:72527445-72527467 CAACCTAGATGTTCTTTAACAGG - Intronic
932983214 2:76695709-76695731 CAACCAAGATGTCCTGTAACAGG - Intergenic
933113118 2:78429792-78429814 CACCCCAGAGGTCCCATAACAGG + Intergenic
933203139 2:79474242-79474264 CAACCCAAATGTCCCTGAACTGG + Intronic
933255943 2:80080615-80080637 CAACACAGTTCTCTCTAAACAGG - Intronic
933263816 2:80159035-80159057 CAACCCACATGTCCTTCAATGGG - Intronic
933611229 2:84437806-84437828 CAACCCAGATGTCTCTCAACAGG + Intronic
933657011 2:84896909-84896931 CAACCAAAATGTCCTTCAACAGG + Intronic
933763297 2:85689736-85689758 TAACCCAAATGTCCATCAACAGG - Intronic
933929550 2:87134843-87134865 CAACCCAAATGTCCATCATCAGG - Intergenic
934478149 2:94606598-94606620 CAACCCAAATGTCCATCCACAGG + Intergenic
934658061 2:96127010-96127032 AAACCCAAGTGTCCCTCAACTGG + Intronic
934665859 2:96170003-96170025 CAACTCAAATGTTCCTCAACAGG + Intergenic
934722527 2:96591081-96591103 CAAACTAGATGTCCCTCAATAGG + Intergenic
934885239 2:98018626-98018648 CAACCCACATGTCCTTTAATGGG - Intergenic
935034334 2:99353929-99353951 CAACCCACATGTCCTTTAATAGG - Intronic
935449852 2:103196871-103196893 CAACCCAGATGTCCTTCAGGGGG + Intergenic
935467727 2:103418693-103418715 CAACCCAAATGTCCACCAACTGG - Intergenic
936097247 2:109539926-109539948 CAACCCAAGTGTCCATCAACTGG - Intergenic
936363384 2:111828536-111828558 CAACCCAAATGTCCATCATCAGG + Intronic
936384370 2:112015082-112015104 CAACCCATATGTCCCTAAACAGG - Intronic
936727728 2:115341840-115341862 CAACCAAGATGTCCTTCAATAGG - Intronic
936800889 2:116264206-116264228 CATTCCAGATGTCCTTCAACAGG + Intergenic
936999014 2:118446058-118446080 CAACCCAAATGTCTATCAACAGG + Intergenic
937349003 2:121148059-121148081 CAACCCAAATGTCCTTCAATGGG + Intergenic
937899522 2:127007391-127007413 CAACTCAAATGTCCATCAACAGG - Intergenic
937978733 2:127598010-127598032 CAGCCCAGATGTCCTTCTACAGG - Intronic
938019904 2:127897717-127897739 GAGCCCAGATGTCCTTCAACAGG + Intergenic
938090480 2:128428308-128428330 CAGCCCAGATGTCCTTCAACAGG - Intergenic
938098858 2:128484136-128484158 TAACCCAAATGTCCATCAACTGG + Intergenic
938143532 2:128814983-128815005 CAACTCACATATCCTTAAACTGG + Intergenic
938391394 2:130909261-130909283 CAACCCAAATGTCCATCAGCAGG + Intronic
938404597 2:131023851-131023873 CAATCCACATATCCTTAAACAGG + Intronic
938970745 2:136429182-136429204 CAACCAAGATGTCCTTCAATGGG - Intergenic
939007715 2:136808484-136808506 CAACCAAGATGTCCTTCAATAGG - Intronic
939183777 2:138835736-138835758 CAACGCAAATGTCTATAAACAGG - Intergenic
939573655 2:143869799-143869821 CAACCCACATGTCCTTCAAAGGG + Intergenic
939614995 2:144352574-144352596 CAACCTAAATGTCTCTCAACAGG + Intergenic
939697275 2:145342430-145342452 CACCCCAGATGTCCTTCAACAGG + Intergenic
939834697 2:147114377-147114399 CAACCTAAATGTCCATCAACAGG - Intergenic
939859822 2:147406070-147406092 CAACTCAGATGTCCTTTCACTGG + Intergenic
939962046 2:148573749-148573771 CAACCCAGGTGTCCTTCAATAGG + Intergenic
940015954 2:149104151-149104173 CAACCCAAATGTCCATCAACAGG - Intronic
940232615 2:151473057-151473079 CAACCCAAATGTCTGTCAACTGG - Intronic
940298217 2:152151908-152151930 CAACCCAGATGTTCATGAACTGG - Intronic
940620553 2:156107721-156107743 CAACTCAAATGTCCATCAACAGG + Intergenic
940670832 2:156665895-156665917 CAACCAAGATGTCCTTCGACAGG - Intergenic
940853314 2:158708597-158708619 CAACCTAGATGTCCTTCAATAGG - Intergenic
941024300 2:160441262-160441284 CAATCCAAATGTCCATTAACAGG - Intronic
941030188 2:160502129-160502151 CAACCCAAATATCCATCAACAGG - Intergenic
941036383 2:160573404-160573426 CAACCTAGAAGTCCTTCAACAGG + Intergenic
941101449 2:161300337-161300359 CAACCCAAATGTCCATCAACTGG + Intergenic
941393302 2:164943334-164943356 CGACACAAATGTCCCTGAACTGG + Intronic
941715831 2:168762249-168762271 CAACCAAAATGTCCCATAACAGG - Intronic
941849664 2:170166762-170166784 CAACTCAGATGTCCATGACCAGG + Intergenic
941961695 2:171260330-171260352 CAACCCAAATGTCCATGTACAGG + Intergenic
941996730 2:171608304-171608326 CAACCTAAATGTCCTTCAACAGG + Intergenic
941997791 2:171617037-171617059 CAACCCAGGTGACACTAAACTGG - Intergenic
942473284 2:176285782-176285804 CAACCCAGATGTTCATTAACTGG - Intronic
942510103 2:176688967-176688989 CAACCGAAATGTCCATCAACAGG + Intergenic
942526563 2:176859574-176859596 TAACCCAAATATCCCTCAACTGG + Intergenic
942549737 2:177102658-177102680 CAACCCAAATATCCAAAAACTGG + Intergenic
942589940 2:177532714-177532736 CAGCCCAGATGTCCTTCAGCTGG + Intronic
942796804 2:179830470-179830492 CAACCTAGATGTCCTTCAAAAGG + Intronic
943040435 2:182797917-182797939 CAACCCAAATGTCCATCAACAGG + Intergenic
943068390 2:183113108-183113130 CAACCCAGATGTTCTTCAATGGG + Intergenic
943267921 2:185760564-185760586 CAATCCAAATGTCCATCAACAGG + Intronic
943388876 2:187236412-187236434 CAACAAAGATGTCCCTCAAAAGG - Intergenic
943402640 2:187434694-187434716 CAATCCAGATGTTCCTCAGCAGG + Intronic
943434928 2:187853250-187853272 CAACCAAGATGTCCTTCAATAGG - Intergenic
943596218 2:189860477-189860499 CAACCCAAATGTCCATCAACTGG - Intronic
943801394 2:192062394-192062416 CAACCCAGATATCCTTCAACAGG - Intronic
943848347 2:192681154-192681176 CAACACAGATGCCCTTCAACAGG - Intergenic
944091659 2:195918516-195918538 CAACCAAGATGTCCTTCGACAGG + Intronic
944144415 2:196490698-196490720 CAACCCAAATGTCCATGAACTGG + Intronic
944620703 2:201512677-201512699 CAACCCAGATGTCCTTTAACTGG - Intronic
944758867 2:202792431-202792453 CAACCCAAATGTCCATCAACTGG + Intronic
945237908 2:207649652-207649674 CAACCCAAATGTCCATCAAATGG + Intergenic
945351002 2:208779721-208779743 CAACCCAAATGTACTTCAACAGG - Intronic
945709328 2:213276893-213276915 CAACCAAGAGATCCCTAAAGAGG - Intergenic
946144779 2:217722133-217722155 TAACCCAGATGTCCTTTAACAGG + Intronic
946204095 2:218090924-218090946 CAACTCAGATGTCCATCCACAGG - Intergenic
946290778 2:218743445-218743467 CAACCCAAATATCCTTCAACAGG - Intronic
946598256 2:221330761-221330783 CAACCAAGATGTCCTTCAACAGG + Intergenic
947131235 2:226927375-226927397 CAACCCAAATATCCTTCAACTGG - Intronic
947273250 2:228362921-228362943 CAACCCAGATGTTCTTCAACTGG - Intergenic
947346941 2:229201522-229201544 CAACCCAGGTGTCCATTGACAGG - Intronic
947655368 2:231822128-231822150 CCATCCAGATGTCCTTTAACAGG - Intergenic
947683988 2:232064434-232064456 CAACCAAAATGTCCTTCAACTGG - Intronic
947737858 2:232466498-232466520 CAACCTAAGTGTTCCTAAACGGG - Intergenic
947784004 2:232798307-232798329 CAACCCAGATGTCCTTCAATGGG - Intronic
948077894 2:235180747-235180769 CAACACAGTTATCCCTCAACAGG + Intergenic
948282867 2:236761628-236761650 CAACCCTAAAGTCCCTAAACTGG - Intergenic
948283196 2:236764468-236764490 CAACCCCGAAGTCCCTAAACTGG - Intergenic
948787750 2:240361798-240361820 CAACCCAGATATCCCTGCACAGG + Intergenic
948796515 2:240405429-240405451 CAACTCAAATGTCCATAAACAGG - Intergenic
1169297744 20:4414582-4414604 CAACCCAAATGCCCTTCAACAGG - Intergenic
1169312630 20:4559390-4559412 CAACCCAAATGTCCTTCAATAGG + Intergenic
1169496227 20:6118130-6118152 CAACCCAAATGTCCATTAAGAGG + Intronic
1169514116 20:6297704-6297726 CAACCCAAGTGTCCCTCAATAGG - Intergenic
1169884160 20:10379669-10379691 CAACCCAAATGTCCATCAATGGG + Intergenic
1170102528 20:12718207-12718229 CAACCCAAATGTCCATCAATTGG + Intergenic
1170193156 20:13663664-13663686 CAACCAAGATGTCCTTCAATAGG - Intergenic
1170283802 20:14682692-14682714 CTACTCAGATGTCCATCAACAGG - Intronic
1170497608 20:16941340-16941362 CAACCCAAATGTCCATTAACAGG - Intergenic
1170641757 20:18160543-18160565 CAACCAAAATGTCCATCAACAGG - Intronic
1170741546 20:19062839-19062861 CAACACAGATGTCCTTCAATAGG + Intergenic
1170951556 20:20940895-20940917 CAACCCAAATGTCCATCAAGAGG - Intergenic
1172111597 20:32548814-32548836 CAATCCAAATGTCCATTAACAGG + Intronic
1172220561 20:33271844-33271866 CAACCCAAGTGTCCATCAACAGG + Intergenic
1172811731 20:37652942-37652964 CAACCCAAAGGTCCATCAACTGG + Intergenic
1172863039 20:38071433-38071455 CAACTCAAATGTCCATAGACAGG - Intronic
1173292282 20:41725457-41725479 CAACCCCAATGTCCATCAACAGG - Intergenic
1173663441 20:44749942-44749964 CAACCCAAGTGTCCCTCGACTGG - Intronic
1173689587 20:44950029-44950051 TAACCCAGATCTCCATAAATGGG - Intronic
1174024527 20:47562150-47562172 CAACCAAGATGTCCTTCAATAGG - Intronic
1174675742 20:52352411-52352433 CAACCCACATGTCCATCAACAGG - Intergenic
1174982601 20:55413557-55413579 TAACCCAGATGTTCTTCAACAGG + Intergenic
1175111555 20:56652071-56652093 CAACCCAAATGTCTATCAACTGG - Intergenic
1175261595 20:57677791-57677813 CAATCCAGATGTCCCTCAACAGG + Intronic
1175270864 20:57733367-57733389 CAGCCCAAATGTCCCGCAACAGG - Intergenic
1175519753 20:59592894-59592916 CAACCAAGATGTCCTTCAGCAGG - Intronic
1176273675 20:64250310-64250332 CAACCAAGATGTCCTTCAACAGG - Intergenic
1177001087 21:15614060-15614082 CAACCCAGATGTCCTTTAGCAGG + Intergenic
1177185394 21:17788043-17788065 CAACTCAAATGTCCATCAACAGG + Intergenic
1177274506 21:18891412-18891434 CAACCAAGATGTCCTTCAATAGG + Intergenic
1177335157 21:19715198-19715220 CAACCCAAATGTTCCTTAATGGG + Intergenic
1177447122 21:21212150-21212172 CAACCCATATGTCCTTCAAGAGG + Intronic
1177641398 21:23848329-23848351 CAGCCCAAATGTCCTTCAACAGG - Intergenic
1178474322 21:32923021-32923043 CAACCCAGTTGCTCATAAACTGG + Intergenic
1178603432 21:34014688-34014710 CAACCAAGATGTCCTTCAATAGG + Intergenic
1178675696 21:34629886-34629908 CAACCAAGATGTCCTTCAATAGG + Intergenic
1178999077 21:37437750-37437772 CAACCCAAATGTGCTTCAACAGG - Intronic
1179056529 21:37940865-37940887 CAACCCAGATGTCTTTTAATAGG - Intergenic
1179193841 21:39146311-39146333 CAATCCAAATGTCCATTAACTGG - Intergenic
1179466073 21:41574106-41574128 CAACCCAAATGTCCTCCAACAGG - Intergenic
1179475866 21:41643630-41643652 CAACCCAAATGTCCATCAACAGG + Intergenic
1179715816 21:43287601-43287623 CAACCCAGATGTCCTTCACCAGG - Intergenic
1180888811 22:19270061-19270083 CAATCCAAATGTCCATCAACTGG + Intronic
1181442540 22:22944193-22944215 CAGCCCAGATGTCCATCCACTGG - Intergenic
1182673725 22:32019871-32019893 CAACCCAATTGTCCATCAACAGG - Intergenic
1182902021 22:33906366-33906388 CAACCCAGGTGTCCTAATACTGG - Intronic
1182992360 22:34780321-34780343 CAACACAAATGTCCTTCAACTGG + Intergenic
1183054713 22:35297793-35297815 CAACTCATATGCCCCCAAACAGG - Intergenic
1183128210 22:35805718-35805740 CAACCAAGATGCCCTTAAATTGG + Intronic
1183374032 22:37452364-37452386 CAACCCAAATGTCCATCAACAGG + Intergenic
1183471553 22:38009918-38009940 CAACCCAAATGTCTATCAACAGG - Intronic
1183761460 22:39823254-39823276 CAATCCAGAGGTCCTTTAACAGG - Intronic
1183890037 22:40919757-40919779 CAACCAAAATGTCCATCAACAGG + Intronic
1183971844 22:41483227-41483249 CAACACAGTTTTCCCAAAACTGG - Intronic
1183972764 22:41490505-41490527 CAACCCAATTGTCCATACACAGG - Intronic
1184062690 22:42093612-42093634 CAACCAAGATGTCCTTTAGCAGG + Intergenic
1184362795 22:44028548-44028570 CAACCAAGATGTCCTTCAGCAGG - Intronic
1184511740 22:44937674-44937696 CAACTCAAATGTCCATCAACTGG + Intronic
1184618490 22:45654914-45654936 CAACCCAAATGTCCATCACCCGG - Intergenic
949177896 3:1088892-1088914 CAACACTGATGTCCATCAACAGG - Intergenic
949238910 3:1846149-1846171 CAACCAAGATGTCCTTCAATAGG + Intergenic
949307914 3:2663739-2663761 CAACCCACATGTCCATCAGCTGG + Intronic
950373389 3:12550185-12550207 CAACCAAGATGTCCCTCAGCAGG + Intronic
950483285 3:13257915-13257937 CAACCAAGATGTCCCTCAGCAGG + Intergenic
950625763 3:14245579-14245601 CAACTCAAATGTCCCCCAACTGG - Intergenic
950635263 3:14309809-14309831 CAACCAAGATGTCCTTCAGCAGG + Intergenic
950733559 3:14984686-14984708 TAACCCAAATGTCCATCAACAGG - Intronic
950878157 3:16297591-16297613 CAACCCAAATGTCCCTCAGCAGG + Intronic
950958032 3:17075919-17075941 CAACACAAATGTCCATAAATTGG - Intronic
951331726 3:21377560-21377582 CAACCCAAATATCCATCAACTGG + Intergenic
951459040 3:22929150-22929172 CAACCTAGCTGTCCATCAACAGG + Intergenic
951612012 3:24500153-24500175 CAACCCAAATGTCCATCAATTGG - Intergenic
951635863 3:24775604-24775626 CAATCCAGATGTCCTTCAACTGG - Intergenic
951843848 3:27064154-27064176 CAACTCAGCTCTCCCTAAACTGG - Intergenic
951983866 3:28596212-28596234 CAGCCCAGAAGTACCTCAACTGG - Intergenic
952191880 3:31031544-31031566 CAACTGAGATGTCCCTCAATAGG - Intergenic
952288670 3:31993962-31993984 CAACCCAAAGATCCCTCAACTGG + Intronic
952475333 3:33703834-33703856 CAACCAAGATGTCCCTCAGTAGG + Intronic
952477249 3:33723115-33723137 CAACCCATATATCCATCAACTGG + Intergenic
953172388 3:40519074-40519096 CAACCCAAATGGCCATCAACAGG - Intergenic
953376588 3:42433521-42433543 AAACCCAAATGTCCATCAACAGG + Intergenic
953586834 3:44209054-44209076 CAACTCAAATGTCCATCAACTGG + Intergenic
953710024 3:45262139-45262161 CAACCCAAATGTCTATCAACAGG + Intergenic
954270495 3:49504397-49504419 CAACCCAGATGTCCTTCAATGGG - Intronic
954595003 3:51816820-51816842 CAACCCAAATGTCCACCAACAGG - Intergenic
954857363 3:53657129-53657151 CAACCCATATATCCCTCAACGGG + Intronic
954893139 3:53950644-53950666 CAACCCAAATGTTCATCAACTGG + Intergenic
955668546 3:61376799-61376821 CAACCCAAATGTCCCTAGATGGG - Intergenic
956238746 3:67105532-67105554 CAACCAAGATGTCCTTCAATAGG + Intergenic
956392276 3:68786003-68786025 CAACCCATATGTCCATCAATAGG + Intronic
956492640 3:69790015-69790037 CAACCCAAATGTCCATCAGCAGG + Intronic
956542238 3:70353813-70353835 CAACTCAGATGTCCTTCAATGGG + Intergenic
956654799 3:71538556-71538578 CAACTCAGATGTCTATCAACTGG - Intronic
956690509 3:71873979-71874001 CAACCAAGATGTCCTTTAATGGG + Intergenic
956759420 3:72425764-72425786 AAACTCAAATGTCCCTCAACAGG + Intronic
956762201 3:72453823-72453845 CAACCCAAATGCCCTTTAACTGG + Intergenic
956795783 3:72717308-72717330 CAACCCAAATGTCCATCAAAAGG + Intergenic
957554540 3:81749190-81749212 CAATCCAAATGTCCTTCAACAGG + Intronic
957755097 3:84475032-84475054 CAACCTACATGTCCATCAACAGG + Intergenic
957902205 3:86509103-86509125 CAACCAAGATGTCCTTCAATAGG + Intergenic
958540629 3:95466207-95466229 CAACCAAGATGTCCTTTAGCGGG - Intergenic
958818059 3:98939472-98939494 TAACCCAGATGCCTTTAAACAGG + Intergenic
959284912 3:104396482-104396504 CAACCCAAATGTCCATCAATGGG - Intergenic
959509303 3:107191757-107191779 CAACCCAGATGTCCTTCAACAGG + Intergenic
959535453 3:107480212-107480234 CAACCCAAATGTCCATCAATTGG + Intergenic
959729349 3:109583180-109583202 CAACCCAAACGTCCATCAACAGG - Intergenic
959962331 3:112312639-112312661 CAACCCAGATGTCCATTATCTGG - Intergenic
960016397 3:112894190-112894212 CAACTCAAATGTCCATTAACAGG + Intergenic
960653229 3:119975071-119975093 AAACCAAGATGTCCCGCAACAGG + Intronic
961021060 3:123507345-123507367 CAACCCAAATATCCATCAACTGG + Intronic
961065751 3:123875209-123875231 CAGCCCAAATGTCCTTCAACTGG + Intronic
961392699 3:126564430-126564452 CAACCAAAATGTCCTTTAACAGG - Intergenic
961497217 3:127303024-127303046 CAACCAAGATGTCCTTTAATAGG - Intergenic
961513262 3:127417296-127417318 CAACTCAAATGTCCCTCAACTGG + Intergenic
961612074 3:128147836-128147858 CAACCCAAATGCCCTTCAACAGG + Intronic
961708880 3:128811387-128811409 CAACTCAAATGTCCATCAACTGG + Intronic
962024014 3:131528218-131528240 CAACCCAGATCTCCCCATTCAGG + Intergenic
962121217 3:132562068-132562090 CAACCGAAATGTCCTTCAACAGG - Intronic
962121847 3:132569561-132569583 CAACCCAGATGTCCCTCAACAGG + Intronic
962450489 3:135512116-135512138 CAACCCAAATGTCCATCAATAGG + Intergenic
962594413 3:136925737-136925759 CCACCCAGATGTCCTTCAACAGG - Intronic
962597669 3:136963209-136963231 CGGCCCAGATGTCCTTCAACAGG - Intronic
962744388 3:138386810-138386832 CAACCCAAATGTCCATTGACTGG - Intronic
962846810 3:139280510-139280532 CAGCCCAGATGTCCCTTGCCTGG - Intronic
963101030 3:141603982-141604004 CAACCTAAATGTCCATCAACTGG - Intronic
963384789 3:144577882-144577904 CAACCCAAATGTTCATCAACAGG + Intergenic
963726223 3:148924670-148924692 CAACCCAGATGTCATTAAGTGGG + Intergenic
963928878 3:150981123-150981145 CAACCCAAATGTTCATCAACTGG + Intergenic
964105882 3:153039037-153039059 CAACCCACATGTTCCTTAGCAGG - Intergenic
964215142 3:154271870-154271892 CAACTCAAATGTCCATCAACTGG + Intergenic
964377325 3:156061245-156061267 CAACCCAAATGTCCATCAGCTGG - Intronic
964725572 3:159810708-159810730 CAATCCACATGTCCATCAACTGG - Intronic
965396771 3:168168644-168168666 CAACCCAGGTGTCCTTCAATGGG - Intergenic
965608706 3:170522381-170522403 CAACCCAGTTGTCCTCCAACTGG + Intronic
965675355 3:171189321-171189343 CAACCCAGGTGCCCATCAACAGG - Intronic
966740677 3:183230481-183230503 CAACCCAAATGTCCATAAAAAGG - Intronic
966759590 3:183405688-183405710 CAACCCAGGTGTCCCTCACCTGG - Intronic
966956082 3:184880564-184880586 CAACCCAGATATTCTTCAACCGG - Intronic
967370686 3:188742385-188742407 CAACCCAAATGTTCATTAACAGG + Intronic
967374602 3:188786677-188786699 AAACCCAGATGTCTTTCAACAGG + Intronic
967494455 3:190127305-190127327 CAACCCTAATATACCTAAACAGG - Intergenic
967879657 3:194292340-194292362 CAACCCAAATGTCCCTCAATTGG + Intergenic
968027495 3:195454764-195454786 CAATCCACATGTCCATCAACAGG + Intergenic
968063092 3:195741034-195741056 CAACCAAGATGTCCTTCAGCAGG - Intronic
968475188 4:802147-802169 CAACTCAAATGTCCATCAACAGG + Intronic
968496110 4:916928-916950 CAACCCAAATGTCCATCAACAGG + Intronic
968496811 4:922894-922916 CAGCCCAGATGTCCTTCCACGGG + Intronic
968851577 4:3083881-3083903 CAGCTCAGATGTCCTTCAACAGG + Intronic
968886548 4:3337461-3337483 CCACCCAGATGTCCATCATCAGG + Intronic
968961904 4:3749900-3749922 CCACCCAGATGTCCGTCATCAGG - Intergenic
969038035 4:4271834-4271856 CCACCCAGGTGTCCCTCCACAGG + Intronic
969068096 4:4506287-4506309 CAACACAAATGTCCTTCAACAGG + Intronic
969193173 4:5540420-5540442 CGACCCAGATTTCCATCAACAGG + Intergenic
969699461 4:8760074-8760096 CAACCCAGATGTCCCTCAAGTGG + Intergenic
969864081 4:10061937-10061959 CAACCTAGACGTCCATCAACAGG - Intergenic
970205452 4:13651122-13651144 CAACCCAAATGTCACTCAAGAGG - Intergenic
970577740 4:17444326-17444348 CAACCCAGTTGTGGCTAAAAGGG - Intergenic
971418369 4:26453945-26453967 TAACCCAGATGCCCATCAACTGG + Intergenic
971433263 4:26591294-26591316 CAACCAAGATGTCTATCAACAGG - Intronic
971497402 4:27281489-27281511 CAACACAAATGTCCATCAACGGG + Intergenic
971499937 4:27307761-27307783 CAACACACATGTCCCCAAATTGG + Intergenic
971815792 4:31487046-31487068 CAACCAAGATGTCCTTCAATAGG + Intergenic
972068057 4:34977276-34977298 CAACCAAGATGTCCTTGAATGGG - Intergenic
972182469 4:36485778-36485800 CAACCCAGATGTCCTTCAGCAGG + Intergenic
972663309 4:41139514-41139536 CAACCAAGATGTCCTTCAATAGG + Intronic
972778135 4:42262253-42262275 CAACCAAGATGTCCTTCAATAGG + Intergenic
972784341 4:42313110-42313132 CAACCAAGATGTCCTTCAATAGG - Intergenic
972834913 4:42858634-42858656 CAATCCAAATGTCCATCAACAGG - Intergenic
973712283 4:53641922-53641944 CAACCCAAATGCCCATCAACAGG - Intronic
973723907 4:53752972-53752994 CAACCCAAATGTCCATCAACAGG - Intronic
974451143 4:62061859-62061881 CAACCCAAATTTCCTTCAACTGG - Intronic
975114335 4:70662424-70662446 CAACCCAGATTCCCATAGACTGG - Intronic
975225731 4:71869850-71869872 TAACGCAGATGTCCTTCAACAGG - Intergenic
975340937 4:73239385-73239407 CAACCAAAATTTCCATAAACTGG + Intronic
975631288 4:76405285-76405307 CAGCCAAGATGTCCCTCAAAAGG + Intronic
975776237 4:77790307-77790329 CAACCCAGATGTCCTTCAGTAGG - Intronic
975864312 4:78710475-78710497 CAACCCAAAAGTCCATCAACAGG - Intergenic
975884559 4:78949282-78949304 CAACCCAGATGTCCTTCAACAGG - Intergenic
975960120 4:79892565-79892587 CAACACAAATGTCCATCAACAGG + Intergenic
975977072 4:80111675-80111697 CAACCAAGATGTCCTTCAATAGG + Intronic
976318958 4:83689639-83689661 CCACCCATATGTCCTTCAACAGG - Intergenic
976471956 4:85439213-85439235 CAACCCAGATGTCCGTTGATTGG - Intergenic
976871813 4:89803437-89803459 CAACCAAGATGTTCCTCAATAGG - Intronic
977347015 4:95828969-95828991 CAACCCAAATGTCCATCAATGGG + Intergenic
977428902 4:96906418-96906440 CAACCCAAATGTCTATTAACAGG + Intergenic
977488792 4:97685307-97685329 CAACCAAGATGTCCTTCAACAGG + Intronic
977745881 4:100546907-100546929 CAACCCAAACGTCCATCAACAGG - Intronic
977973389 4:103236874-103236896 CAACTCAAATGTCCTTCAACGGG + Intergenic
978048711 4:104167895-104167917 CAACCCTCATGTCCATCAACAGG - Intergenic
978123829 4:105111308-105111330 CAACCCAAGTGTCCATCAACAGG + Intergenic
978733055 4:112053128-112053150 CAGCCTAGATGTCCTTCAACAGG - Intergenic
978823799 4:112996068-112996090 CAACCCAAATGTCTATCAACTGG + Intronic
978882818 4:113728245-113728267 CAATCTAAATGTCCCTCAACAGG + Intronic
978930621 4:114306989-114307011 CAACCCAAATGTCCATCAACAGG - Intergenic
979306017 4:119144356-119144378 CAACCCAGATGTACTTCAATGGG - Intronic
979374847 4:119934102-119934124 CAAGCCAGAAGTCCTTCAACAGG + Intergenic
979383798 4:120040307-120040329 CAAACCAGAAGTCCTTCAACAGG - Intergenic
979587399 4:122437174-122437196 CAACTCAAATGTCCCTACATGGG - Intergenic
979663131 4:123281682-123281704 CCACCAAGATGTCCTTCAACAGG + Intronic
979672489 4:123374635-123374657 CAATCCAGAGGTCCTTCAACAGG - Intergenic
979693573 4:123586658-123586680 CAACTCAAATGTCTCTCAACTGG + Intergenic
980001368 4:127492942-127492964 CAACCAAGATGTCCTTCAGCAGG + Intergenic
980121073 4:128728550-128728572 CAACCGAAATGTCCATCAACAGG + Intergenic
980131546 4:128820877-128820899 CAAACCAGATGTTCTTATACAGG - Intronic
980213522 4:129821060-129821082 CAACCTAGGTGTCTATAAACTGG + Intergenic
980441984 4:132860622-132860644 CAACCAAGATGTCCTTCAATAGG - Intergenic
980502775 4:133678046-133678068 CAACCAAGATGTCCTTCAATAGG - Intergenic
981136543 4:141217271-141217293 CAACCCAATTATCCCTTAACAGG - Intergenic
981445335 4:144830215-144830237 CAACCCCAATGTCCATCAACAGG + Intergenic
981554271 4:145976032-145976054 CAATCCAGATGTCCTTCGACGGG + Intergenic
981794260 4:148577925-148577947 CAACCCAAATGTGCATCAACTGG - Intergenic
982058569 4:151578841-151578863 CAACCAAGATGTCCTTTAGCAGG + Intronic
982098425 4:151944965-151944987 CAACCCAAATGTCCCTCAACAGG + Intergenic
983876336 4:172880246-172880268 CAACCCAAACGTCCATCAACAGG + Intronic
983921364 4:173349276-173349298 CAACCCAGATGTCCTTCACTGGG + Intergenic
984023543 4:174516235-174516257 CAACCTAGATGCCCATCAACGGG + Intronic
985015370 4:185628081-185628103 CAACCAAGATGTCCTTCAATAGG - Intronic
985022502 4:185706907-185706929 CAACCCAAATGCCCCTGAACAGG - Intronic
985145788 4:186893390-186893412 CAACCCAGATATCCATGAAAAGG + Intergenic
985251675 4:188030823-188030845 CAACCCAAATGTCCATCAGCTGG + Intergenic
985305879 4:188538950-188538972 CAACTAAAATGTCCATAAACAGG - Intergenic
985841992 5:2313538-2313560 CAAACCAGATGTCCTTCAATGGG - Intergenic
985990522 5:3556414-3556436 CAACCAAGATGTCCTTCAACAGG + Intergenic
986154973 5:5165336-5165358 CAATCCAAATGTCCATTAACTGG - Intronic
986166331 5:5274596-5274618 CAACCAAGATGTCCTTAAGCAGG - Intronic
986325870 5:6673675-6673697 CAACCAAGATGTCCTTCAATAGG + Intergenic
987102355 5:14603223-14603245 CAATCCAGATGTCCTTCAACTGG - Intronic
987912101 5:24161015-24161037 CAACCTAAATGTCCATCAACAGG + Intronic
987945709 5:24605803-24605825 CAACCCAAATGTCCTCAAATGGG + Intronic
988322516 5:29717502-29717524 CAACTCAAATGTCCATCAACTGG + Intergenic
988372266 5:30386632-30386654 CTACCAAGATGTCCTTCAACAGG + Intergenic
988664824 5:33314729-33314751 CAACCCAAATGTCTCTCAATTGG + Intergenic
988895467 5:35668253-35668275 CAATCCAGATATCTCTCAACAGG + Intronic
988937213 5:36096484-36096506 CAACCAAGATGTCCTTCAATGGG - Intergenic
989230768 5:39084317-39084339 CAACCCAAATGTCTCTCAACTGG + Intergenic
989462797 5:41720304-41720326 CAGCCCAGATATCCTTAAATGGG - Intergenic
989595130 5:43149438-43149460 CAACCTAAATGTCCATCAACAGG - Intronic
989642432 5:43595991-43596013 CAGCCCATATGTCCTTCAACAGG - Intergenic
989822944 5:45817333-45817355 CAACCAAGATGTCCTTTAATAGG + Intergenic
989980056 5:50632850-50632872 CAACCAAGATGTCCTTCAATAGG + Intergenic
990562812 5:57000530-57000552 CAACCCAGATGTCCTTCAAAGGG + Intergenic
990971560 5:61512362-61512384 CAATCTAGATGTCCTTCAACTGG - Intronic
991223115 5:64238237-64238259 CAACCCAAATGTCCATTAACAGG - Intronic
991613289 5:68470125-68470147 GAACCCAGAGGTCCCTATAGAGG - Intergenic
991621975 5:68554590-68554612 CAACCCAAATGTCCTTCAATAGG - Intergenic
991627351 5:68617610-68617632 CAACCCAAATGTCTATCAACAGG + Intergenic
991700271 5:69310579-69310601 CCACCCAAATGTCCATCAACTGG + Intronic
991986695 5:72295307-72295329 CAACCTAGAGGTCCATAAAAAGG + Intronic
992343763 5:75854272-75854294 CAACCCAAATATCCATCAACAGG - Intergenic
992383228 5:76259047-76259069 CAACCCAAATGTCCCCCAATAGG - Intronic
992467030 5:77016147-77016169 CACCCCAGGTGTCCCTACCCTGG - Intergenic
992694118 5:79267781-79267803 CAACCAAGATGTCTTTCAACAGG - Intronic
992697737 5:79307147-79307169 CAACCAAGATGTCCTTCAATAGG - Intronic
992699921 5:79331660-79331682 TAACCCAGATGTCCATCAACAGG + Intergenic
992973772 5:82090354-82090376 CAACCCACATGTCCTTTAATGGG + Intronic
993067761 5:83121189-83121211 CAACCCAAATGTCCACCAACTGG - Intronic
993473284 5:88333013-88333035 TAACCCAGATATCCTTCAACAGG - Intergenic
993599232 5:89900312-89900334 CAACACAAATGTCCATCAACTGG - Intergenic
993907287 5:93637327-93637349 CAACCCAAATGTCCTTCAACAGG - Intronic
994121293 5:96116347-96116369 TAACCCAGATGTCCATCAACTGG - Intergenic
994668576 5:102738227-102738249 CAACCCAGATGTCTTTCAACGGG + Intergenic
994918692 5:106013010-106013032 TATCCCAGATGTCCTTCAACAGG + Intergenic
995077411 5:108002622-108002644 TAACCCAAATGTCCATCAACTGG + Intronic
995146355 5:108791043-108791065 CAACCCAAATATCCATCAACAGG - Intronic
995397996 5:111708876-111708898 CAACCCAGATGTCTTCTAACAGG - Intronic
995602726 5:113815985-113816007 CAACCCAAATGTCCATCAACAGG + Intergenic
995800754 5:115991442-115991464 CAACCAAGATGCCCTTAAATAGG - Intronic
996047361 5:118888501-118888523 CAACCCAAATGTCCATCAATAGG - Intronic
996096408 5:119403657-119403679 CAACCCAGATATCCTTCAATGGG - Intergenic
996187387 5:120493932-120493954 CAACCCAAATGTCCTTCAGCCGG - Intronic
996299979 5:121970056-121970078 CAACCCAGAAGTCAATGAACAGG - Intronic
996326357 5:122279023-122279045 CAACCCACATGACCTTCAACAGG + Intergenic
996424671 5:123301418-123301440 CAACCCAGCAGTCCCTTTACTGG + Intergenic
996495758 5:124153918-124153940 CAACCCAGATGTCCTTCAGTGGG + Intergenic
996622863 5:125531291-125531313 CAACGCAAATGTCCTTCAACAGG - Intergenic
996761848 5:126994110-126994132 CAACCCAAATGTCCTTCAGCTGG + Intronic
996894824 5:128468328-128468350 CAACCCAGATGGCCACAGACTGG - Intronic
997053020 5:130405308-130405330 CAATCCAAATGTCCTTCAACAGG - Intergenic
997292216 5:132745962-132745984 CAACCCAGCAGTCCCTTTACTGG - Intergenic
997494867 5:134314546-134314568 TAACCCACATGTCCATCAACAGG + Intronic
997711933 5:136012774-136012796 CAACCCAAATGTCCCTCAGTGGG - Intergenic
997861806 5:137424601-137424623 CAATCCAGATGGCCATCAACAGG + Intronic
997970970 5:138401516-138401538 CAACCCAAAAGTCCATCAACTGG - Intronic
997982217 5:138475429-138475451 CAGCCCAGATGTCCCTCCACAGG - Intergenic
998455994 5:142273615-142273637 CAACCAAGATGTCTTTAAACAGG + Intergenic
998620147 5:143784715-143784737 CAACACAAATGTCCATCAACAGG - Intergenic
999186139 5:149710796-149710818 CAACACAAATGTCCTTCAACTGG - Intergenic
999312408 5:150559895-150559917 CAACCTAGATGTCCATCCACAGG + Intergenic
999552019 5:152699544-152699566 CAACCAAGATGTCCTTCAATAGG - Intergenic
999700377 5:154222364-154222386 CAATCCAAATGTCCATCAACAGG - Intronic
999700890 5:154227091-154227113 CAACCCACATGTCCATCAACAGG - Intronic
999725127 5:154430657-154430679 GACCCCAGGTGTCCCTAAGCTGG - Intergenic
999749226 5:154614274-154614296 GAACCCAAATGTCCTTCAACTGG + Intergenic
1000280915 5:159781206-159781228 CAACCAAGATGTCCTTCAGCAGG - Intergenic
1000580421 5:163028934-163028956 CAACCAAGATGTCCTTAAGTAGG - Intergenic
1000717826 5:164668523-164668545 CTACCCAGATGTCCTTCAAATGG - Intergenic
1000722433 5:164725115-164725137 CAACCTAGATGTCTTTAAATGGG - Intergenic
1001008519 5:168076136-168076158 CAACCCAAATGTCCATCAACAGG - Intronic
1001077368 5:168640282-168640304 CAGCCCATATGTCCATCAACAGG - Intergenic
1001439619 5:171731967-171731989 TAACCCAGATATCCTTCAACAGG + Intergenic
1001623714 5:173111657-173111679 CAACCCAAATGCCCTTCAACTGG - Intronic
1001857088 5:175022348-175022370 CAAGCCAAATGTCCGTCAACAGG + Intergenic
1001870175 5:175147286-175147308 CAACCCAGGTGTCCTTCAATAGG + Intergenic
1001871026 5:175155995-175156017 CAACCTAAATGTCCATCAACTGG + Intergenic
1002014637 5:176310399-176310421 CAACCCAGATGTCCTACAACAGG + Intronic
1002129277 5:177069969-177069991 CAACCCAGTTGTCCCTCAACAGG - Intronic
1002444596 5:179281588-179281610 CAACCCACATGTCCATCAACCGG - Intronic
1002634635 5:180600994-180601016 CAACCCAGGTGTCCACCAACAGG - Intergenic
1002761055 6:202725-202747 GGACCCAGATGTCCTTCAACTGG + Intergenic
1003002133 6:2346167-2346189 CAACCAAAATGTCCATAATCAGG - Intergenic
1003037025 6:2650608-2650630 CAATCCAAATGTCCATCAACAGG + Intergenic
1003843104 6:10143090-10143112 CAACCAAGATGTCCTTTAGCAGG + Intronic
1004109849 6:12706617-12706639 TAAGCCAAATGTCCCTCAACAGG - Intergenic
1004433241 6:15565424-15565446 CAATCCAAATGTCCATTAACTGG + Intronic
1004444999 6:15689843-15689865 CAACCCATATGTCCATCAACTGG - Intergenic
1004490864 6:16114037-16114059 CAACCCAGATGCCCATCTACAGG - Intergenic
1004806268 6:19206591-19206613 CAACCCAAATGTCCCTCAGATGG - Intergenic
1005453395 6:25995388-25995410 CAACCCACGTGTCCATCAACAGG - Intergenic
1005559811 6:27027122-27027144 CAATCCAAATGTCCATCAACTGG - Intergenic
1005590062 6:27313716-27313738 CAACCAAGAAGTCCTTCAACAGG + Intergenic
1005792201 6:29315117-29315139 CAACCCAGATGTCCATCAACGGG - Intergenic
1006222283 6:32501471-32501493 CAGCCAAAATGTCCCTCAACAGG - Intergenic
1006261939 6:32881821-32881843 TAACCCAGATATCCTTTAACAGG + Intergenic
1006546952 6:34788244-34788266 CAGCCCAGATGTCCTTCAGCAGG + Intergenic
1007048347 6:38800140-38800162 CAACCCAAATGTCCATCAACTGG - Intronic
1007052498 6:38846574-38846596 CAACCCAGAACTCCCTGGACTGG - Intronic
1007361057 6:41356070-41356092 CAACCCACAGGTCCTTCAACTGG + Intergenic
1007883252 6:45191161-45191183 CAACCAAGATGTCCTTCAATAGG + Intronic
1007885385 6:45222788-45222810 CAACTCAGATGTCCTTCAATGGG + Intronic
1007939917 6:45770833-45770855 CAACCCAAATATCCATAAGCAGG + Intergenic
1008039250 6:46778437-46778459 CAACCCAAATGTCCATCAAGTGG - Intergenic
1008067726 6:47068314-47068336 TAACCCAGATGTTCTTCAACAGG + Intergenic
1008097482 6:47354017-47354039 CAACCCAAATGTTCATCAACAGG - Intergenic
1008449446 6:51633455-51633477 CAACCCAAATGTCCTTGAGCAGG + Intronic
1008518681 6:52342754-52342776 CAACCCAAATGTCCTTCAACTGG - Intergenic
1008551535 6:52637271-52637293 CAACCCAAATGTCCATCAGCAGG + Intergenic
1008852817 6:56045103-56045125 TAACCCAGTTGTCCATAAACAGG + Intergenic
1008948010 6:57120317-57120339 CAACCAAGATGTCCTTCAATCGG - Intronic
1009025502 6:57995085-57995107 CAACCCAAATGTCTATCAACAGG - Intergenic
1009448209 6:63768816-63768838 CAACCTAGATGCCCATCAACAGG + Intronic
1009786965 6:68352884-68352906 CAACCAAGATGTCCTTCAATAGG - Intergenic
1009996115 6:70896804-70896826 CAACCCAAATGTCCCTCAGCAGG - Intronic
1010230964 6:73534985-73535007 CGACCCAAATGTCCATCAACAGG + Intergenic
1010776603 6:79893732-79893754 CAATCCAAATGTCCCTCAACAGG + Intergenic
1011133898 6:84079150-84079172 CAACCCAAATGTCCTTCAGCAGG + Intronic
1011254878 6:85409844-85409866 CAACTCAGATGTCCTTCAATGGG - Intergenic
1011278046 6:85648841-85648863 CAACCAAGATGTCCTTCAATAGG + Intergenic
1011305704 6:85923980-85924002 CAACCCTGATGTCCATCAACAGG - Intergenic
1011410807 6:87063929-87063951 AAACTCAGATGTCCATCAACAGG + Intergenic
1011503679 6:88018236-88018258 CAATCCAAATGTCCATCAACCGG - Intergenic
1011566884 6:88684477-88684499 CAACCAAGATGTCCTTGAATAGG + Intronic
1011714098 6:90086230-90086252 CAACCCAGGTGTCCATCTACAGG - Intronic
1011747853 6:90424027-90424049 CAACCCAAATGTCCATCGACAGG - Intergenic
1011752506 6:90467422-90467444 CAACCCAAATGTCCATCTACTGG - Intergenic
1012343801 6:98161349-98161371 CAACCCAAATGTCCATTAAAAGG + Intergenic
1012376331 6:98565826-98565848 CATCCCAGAGGACACTAAACTGG + Intergenic
1012703224 6:102489700-102489722 CAACCCAGATATCCTTGAACAGG + Intergenic
1012766471 6:103372871-103372893 TAACCCAGATGCCCTTCAACAGG - Intergenic
1012810066 6:103945608-103945630 CAACCTAAATGTCCTTCAACAGG - Intergenic
1012913616 6:105144628-105144650 AAACCAAGATGTCCTTAAAATGG - Intergenic
1013222873 6:108095155-108095177 CAACCAAGATGTCCTTCAATAGG + Intronic
1013390100 6:109678155-109678177 CAACCCAGATGTTCTTCAAAAGG + Intronic
1013544508 6:111142961-111142983 CAACCAAGATGTCCTTCAATAGG + Intronic
1013564439 6:111343169-111343191 CAACCCAAATGTCCATCAACAGG + Intronic
1013834192 6:114313430-114313452 CAACCCAAATGTCCAACAACAGG + Intronic
1014029588 6:116685125-116685147 CCACCCAGATGTTCTTTAACTGG + Intronic
1014053253 6:116981365-116981387 CTACCCAAATGTCCATCAACAGG + Intergenic
1014284962 6:119486900-119486922 CAACCCAGGTGTCCACCAACTGG - Intergenic
1014350271 6:120333919-120333941 CAACCAAGATGTCCTTCAATAGG + Intergenic
1014381409 6:120747807-120747829 CAATCTAGATGTCCCTCAACTGG - Intergenic
1014588847 6:123235932-123235954 TAACCCAAATGTCCTTCAACAGG - Intronic
1014596305 6:123344675-123344697 CAACCAAGATGTCCTTCAATAGG - Intronic
1015512827 6:134056100-134056122 CAGCCCAGATGTCCATCAATAGG - Intergenic
1015558950 6:134494324-134494346 AAGCCCAGATGTCCATTAACAGG + Intergenic
1015799882 6:137049520-137049542 CAACCCAAATGTCTATCAACCGG - Intergenic
1015828079 6:137336921-137336943 CAACCAAGATGTCCTTCAAGAGG - Intergenic
1016122558 6:140362306-140362328 CAGCCCAAATATCCCTCAACTGG - Intergenic
1016129619 6:140450283-140450305 CAACCCAAATGTCCCCCAATAGG - Intergenic
1016208095 6:141494834-141494856 CAAACAAGATGTCCTTTAACAGG - Intergenic
1016261716 6:142179463-142179485 CAACCCTGATGTCCACCAACAGG + Intronic
1016608099 6:145957917-145957939 AAACCCAAATGTCCATCAACTGG + Intronic
1016774284 6:147887574-147887596 CAACCCAAATGTCCATCAACAGG - Intergenic
1016853833 6:148646653-148646675 GAACCCAAATGTCCATCAACAGG - Intergenic
1016864636 6:148753572-148753594 CAACCCAAATGTCCATTAATGGG - Intronic
1016942969 6:149499353-149499375 CAACCCAGATGTCCTTCAATGGG + Intergenic
1017059247 6:150466169-150466191 CAACCCAAATGTCCATCAGCAGG - Intergenic
1018627181 6:165791423-165791445 CAACCCAAATGTCCATCAACAGG - Intronic
1019806717 7:3131891-3131913 CAACCCAAATGTCCATCAGCTGG - Intergenic
1019863972 7:3687465-3687487 CATCCCAAATGTCCCTCAGCTGG + Intronic
1019956693 7:4420692-4420714 CAACCAAAATGTCCCTCAATAGG - Intergenic
1020217951 7:6209705-6209727 CAACCAAGATGTCCCTCAATAGG + Intronic
1020391749 7:7665929-7665951 CAACCCAAATGTCCAATAACAGG - Intronic
1020575887 7:9927421-9927443 CAACACATATGTGCTTAAACTGG - Intergenic
1020753873 7:12176209-12176231 CAACTCAAATGTCCATCAACTGG + Intergenic
1020896740 7:13950047-13950069 AAACCCTGATGTTCCTAAAAAGG - Intronic
1020971687 7:14951287-14951309 CAACCAAGATATCCTTTAACGGG + Intronic
1021018201 7:15562473-15562495 TAAGCCAAATGCCCCTAAACTGG - Intergenic
1021591053 7:22262674-22262696 CAACCCAGATGTCCTTCAATTGG + Intronic
1021652863 7:22848385-22848407 CAACCAAGATGTCCTTAAGTAGG - Intergenic
1021693212 7:23249706-23249728 TAACCCAGATGTCCTTTAATGGG - Intronic
1022043828 7:26606994-26607016 CAACCAAGATGTCCCTTAGTAGG + Intergenic
1022354724 7:29602607-29602629 CAACCCAAATGTCCATTAATAGG + Intergenic
1022886935 7:34656216-34656238 CCACCCAAATGTCCATCAACTGG - Intergenic
1022963575 7:35453235-35453257 CAACCAAGATGTCCTTTAATAGG + Intergenic
1023033977 7:36114821-36114843 CAACCAAGATGTCCTTCAATAGG - Intergenic
1023172939 7:37407113-37407135 CAACTAAGATGTCCTTCAACAGG + Intronic
1023234461 7:38069230-38069252 CAGCCCAGGTGTCCCTCAGCAGG + Intergenic
1023643627 7:42286730-42286752 TAACCCAAATGTCTTTAAACAGG + Intergenic
1024032773 7:45478483-45478505 CAACCAAGATGTCCTTCAATAGG + Intergenic
1024126360 7:46301098-46301120 CATCCCAGATATGCATAAACAGG + Intergenic
1024197916 7:47077903-47077925 CAATCCAAATGTCCATTAACTGG + Intergenic
1024223646 7:47307397-47307419 CAACCCAAGTGTCCATCAACAGG - Intronic
1024509810 7:50194990-50195012 CAACCCAAATGTCCATCAGCTGG + Intergenic
1024513702 7:50224538-50224560 CAACCCAAATGTCTATCAACAGG + Intergenic
1024602148 7:50993268-50993290 CAACCTAAATGTCCATCAACAGG + Intergenic
1024726481 7:52202476-52202498 CAACAAAGATGTTCCTCAACAGG + Intergenic
1024863136 7:53869633-53869655 CAATCTAAATGTCCATAAACTGG + Intergenic
1025027559 7:55529954-55529976 CAACCCAGATGTCCATAGGCTGG - Intronic
1026080310 7:67212396-67212418 CAACCAAGATGTCCTTCAATAGG - Intronic
1026246987 7:68629538-68629560 CAACCAAGATGCCCCTCAGCAGG + Intergenic
1026563672 7:71471864-71471886 TAACCCAAATTTCCCTAAGCAGG + Intronic
1026696780 7:72601606-72601628 CAACCAAGATGTCCTTCAATAGG + Intronic
1026792615 7:73344567-73344589 CAACCTAGTTGTCACTAACCAGG + Intronic
1027754116 7:82188762-82188784 CAACTTAGATGTCCATCAACAGG + Intronic
1028064365 7:86363610-86363632 CAACCAAGATGTCCTTCAATAGG + Intergenic
1028077384 7:86533546-86533568 CAAGCCAAATGTCCATAGACTGG - Intergenic
1028437999 7:90827349-90827371 CAACCAAGATGTCCTTCCACAGG - Intronic
1028669293 7:93382792-93382814 CAACCCAGCTGTCCATCAACAGG + Intergenic
1029136921 7:98379666-98379688 CAACCCACATGTCCATCAACTGG + Intronic
1029539611 7:101174756-101174778 CACCTCAGAGGTCCCTAAGCCGG - Exonic
1029910895 7:104146402-104146424 GAACCCAGATGTCCTTCAACAGG + Intronic
1030056797 7:105590321-105590343 CAACCCAAATGTGCATCAACAGG - Intronic
1030116770 7:106067765-106067787 CAACCCAGATGCCCATCAACAGG + Intergenic
1030503838 7:110394787-110394809 CAACCCAAATGTCCATCAAGAGG + Intergenic
1030546574 7:110903652-110903674 CAACCCAGATGTCAATCAGCAGG - Intronic
1030553745 7:110997293-110997315 CAACCCAAATATCCTTCAACAGG - Intronic
1030652354 7:112129144-112129166 CAACCCAAATGTCCTTCAATGGG + Intronic
1030717227 7:112823569-112823591 CAACCCAGATATCCATAAACAGG - Intronic
1030905877 7:115182171-115182193 CAACCCAGATGTCCTTCAATGGG + Intergenic
1031041314 7:116841239-116841261 CAACACAAATGTCCCTCAATAGG + Intronic
1031045656 7:116884665-116884687 CCACCCAAATGTCCATAAATGGG - Intronic
1031168292 7:118258435-118258457 CAACCTAAATGTCCTTAAAGGGG + Intergenic
1031168304 7:118258558-118258580 CAACCTAGATGTCCATAAAGGGG - Intergenic
1031199803 7:118667051-118667073 CAATCCAAATTTCCCTAAACTGG - Intergenic
1031225290 7:119029396-119029418 CAACCAAGATGTCCTTCAATAGG + Intergenic
1031755432 7:125635968-125635990 GAACCCAAATATCCCTCAACAGG + Intergenic
1032027019 7:128451183-128451205 CAACCCAAATGTCCGTCAACTGG - Intergenic
1032272740 7:130425744-130425766 CAACCCCGATGTCCTTCAACAGG + Intronic
1032310779 7:130784851-130784873 CAACCCAAAGGTCCATCAACAGG - Intergenic
1032772707 7:135075481-135075503 CAACCCACATGTTCTTCAACAGG - Intronic
1032973358 7:137191900-137191922 CAATTCAGATGTCCTTCAACAGG - Intergenic
1033293534 7:140109476-140109498 CAACCCAGGTGTCCATCAGCAGG - Intronic
1033381333 7:140822673-140822695 TAACCCAAATGTCCATAAACAGG - Intronic
1033642209 7:143272421-143272443 CAACCCAAGTGTCCTTCAACAGG - Intergenic
1034131410 7:148721838-148721860 CAACCCACATGTCCACCAACAGG - Intronic
1034458314 7:151184030-151184052 CAACCCAAGTGTCCCTCAACGGG + Intronic
1034763873 7:153699232-153699254 CAACCCAAATGCCCATTAACAGG - Intergenic
1034862994 7:154616112-154616134 CCACCCAGATGTCTCTAATTTGG + Intronic
1035069534 7:156131859-156131881 CAACCCAGATGCCCTTCATCAGG - Intergenic
1035857820 8:2995641-2995663 CAACCCAGACGTCCTTCAATGGG + Intronic
1036931491 8:12960551-12960573 CAACCAAGATGTCCTTCAATAGG + Intronic
1037092266 8:14935398-14935420 TGACCCAGATGTCCTTCAACAGG - Intronic
1037592729 8:20326975-20326997 CAACCCAAATGTCTATCAACTGG + Intergenic
1037650270 8:20830855-20830877 CAACCCTAATGTCCATCAACAGG + Intergenic
1037766191 8:21773839-21773861 CAACAAAGATGTCCCCAGACAGG - Intronic
1038197782 8:25384018-25384040 CAATCCACGTGTCCCTGAACTGG + Intronic
1038204044 8:25447756-25447778 CAACCCAAGTGTCCATAAGCAGG + Intronic
1038371434 8:26995909-26995931 CAACCCAAATGTTCATCAACTGG - Intergenic
1038398460 8:27264789-27264811 CAACCAACATGTCCCTCAATAGG + Intergenic
1038508084 8:28103456-28103478 CAACCAAGATGTCCTTCAATAGG - Intronic
1038711113 8:29946682-29946704 CAACCCAAATGTCCATAAATGGG - Intergenic
1038886962 8:31674175-31674197 CAATCCAAATGTCCATTAACTGG - Intronic
1039080594 8:33730422-33730444 CAACCAAAATGTCCTTCAACAGG - Intergenic
1039526515 8:38221079-38221101 CAACCCAGATGTCCTTCAATAGG - Intergenic
1040782502 8:51126291-51126313 TAACCCAAATGTCCTTAAATAGG - Intergenic
1041012134 8:53555449-53555471 CATCTCAGATGTCCATCAACAGG + Intergenic
1041087289 8:54268645-54268667 CAACCAAGATGTCCCTAACCTGG + Intergenic
1041092018 8:54311166-54311188 CAACCCAAATGCCCATCAACAGG - Intergenic
1041126457 8:54645135-54645157 TAACCCAAATGTCCATCAACAGG - Intergenic
1041168975 8:55121113-55121135 CAACCAAGATGTCCTTCAATAGG - Intronic
1041188106 8:55323590-55323612 CAACCCAAATGTCCTTTAACTGG - Intronic
1041498674 8:58515716-58515738 CAACTAAGATGTCCTTCAACAGG - Intergenic
1041559406 8:59197763-59197785 TAACCAAGATGTCCTTAAATAGG + Intergenic
1041892189 8:62881634-62881656 CAACCAAGATGTCCTTCATCAGG - Intronic
1041941618 8:63394308-63394330 CAACCAAGATGTCCTTGAATAGG - Intergenic
1042109470 8:65365801-65365823 AAACCCAAATGTCCATCAACAGG + Intergenic
1042195348 8:66227376-66227398 CAGCCCTGATGTCCTTCAACAGG + Intergenic
1042306080 8:67334651-67334673 CAACCCAAATATCCATCAACTGG + Intronic
1042323202 8:67499893-67499915 CAACCCAGGTATCCATCAACAGG - Intronic
1042673880 8:71295810-71295832 CAACCAAGATGTCCTTCAATTGG + Intronic
1042798425 8:72689791-72689813 CAACCCAAATGTCCACTAACTGG - Intronic
1042870536 8:73394395-73394417 CAACCCAAATGTTCATCAACAGG + Intergenic
1042885300 8:73543024-73543046 CAACCCAAATGTCCATCAACAGG + Intronic
1043029621 8:75117169-75117191 CAACCCAAAAGTCCATAAGCAGG - Intergenic
1043088462 8:75867501-75867523 GAACCCAGATGTCCATCAACAGG - Intergenic
1043365668 8:79530719-79530741 CAACCCAAATGTTCATCAACAGG + Intergenic
1043435677 8:80234361-80234383 CAACCCAAATGTCCACCAACTGG - Intergenic
1043484031 8:80681115-80681137 CAACCCAAATGCCCATCAACAGG - Intronic
1043500322 8:80848013-80848035 CAACCCACATGTCCTTCAATGGG + Intronic
1043698231 8:83249557-83249579 CAACCAAGATGTCCTTCAATAGG + Intergenic
1044181160 8:89196908-89196930 TAACCAAAATGTGCCTAAACAGG + Intergenic
1044453057 8:92360537-92360559 TAAGCCAGATGTTCTTAAACTGG - Intergenic
1044612373 8:94105832-94105854 CAACCAAGATGTCCCTCAATAGG - Intergenic
1044654324 8:94531783-94531805 CTACCCAAATGTCCTTCAACAGG + Intronic
1044828463 8:96221562-96221584 CAACCCAAATGTCAATCAACAGG + Intergenic
1044844618 8:96367883-96367905 CAACCCAGATGTCCTTCAACAGG - Intergenic
1045025821 8:98085489-98085511 CAACCCAAGTGTCCATCAACAGG - Intronic
1045139247 8:99261463-99261485 CAACCAAGATGTCCCTTAGTAGG - Intronic
1045220867 8:100199017-100199039 CAACCCAAAGGTCCATCAACTGG - Intronic
1045251891 8:100489440-100489462 CAACCAAGATGTCCTTCAATAGG + Intergenic
1045661431 8:104441812-104441834 CAACCCAGATGTCCATCAATAGG + Intronic
1045704495 8:104905301-104905323 CAACCCAGATGTCCTTTAATGGG - Intronic
1045952959 8:107872595-107872617 TGACCCAAATGCCCCTAAACTGG + Intergenic
1046085033 8:109422615-109422637 CAACTCAAATGTCCTTCAACGGG - Intronic
1046317062 8:112518008-112518030 CAACCCAAATGTCATTCAACAGG + Intronic
1046774447 8:118148929-118148951 CAACCCAAATGTCCATCAACTGG - Intergenic
1047503431 8:125460097-125460119 CCACCCAAATGTCCATCAACTGG + Intergenic
1048279882 8:133097409-133097431 CAACTCAAATGTCCATTAACAGG + Intronic
1048644569 8:136405221-136405243 CAACCTAAATGTCCATCAACAGG + Intergenic
1048798879 8:138177890-138177912 CTACCCATATGTACCTAAGCTGG + Intronic
1049017015 8:139927700-139927722 CAACCCAAATGCCCATCAACAGG + Intronic
1049522366 8:143100071-143100093 CAACCCAGGTGTCCCTCAGTGGG + Intergenic
1049834369 8:144724669-144724691 GAACCCAAATGTCCAAAAACGGG + Intronic
1050275139 9:3989482-3989504 CAGCCCAGATGTCTCTCACCAGG + Intronic
1051443921 9:17120118-17120140 CAACCCAAATGTCCATCAGCAGG + Intergenic
1051818485 9:21136713-21136735 CAACCAAGATGTCCATCAATAGG + Intergenic
1052682433 9:31710731-31710753 CAACCCAAATTTCCATTAACAGG + Intergenic
1052697274 9:31894033-31894055 CAACCCAGCTGTCTTGAAACAGG + Intergenic
1052726778 9:32238054-32238076 CAACCCAGATGTCCTTCAATGGG + Intergenic
1052786650 9:32834353-32834375 CAACCTAAATGTCCATCAACTGG - Intergenic
1052851796 9:33382978-33383000 CAACCCAAATGTCCATCCACAGG - Intergenic
1052882425 9:33611312-33611334 CAACCCAAATGTCCATCCACTGG - Intergenic
1053279647 9:36810413-36810435 CAACCTAGATGTCTATGAACAGG - Intergenic
1053493916 9:38534471-38534493 CAACCCAAATGTCCATCTACTGG - Intergenic
1053679903 9:40479516-40479538 CAACCCAAATGTCCATCCACAGG - Intergenic
1053929899 9:43107826-43107848 CAACCCAAATGTCCATCCACAGG - Intergenic
1054283811 9:63145419-63145441 CAACCCAAATGTCCATCCACAGG + Intergenic
1054292986 9:63315026-63315048 CAACCCAAATGTCCATCCACAGG - Intergenic
1054391008 9:64619519-64619541 CAACCCAAATGTCCATCCACAGG - Intergenic
1054504718 9:65896807-65896829 CAACCCAAATGTCCATCCACAGG + Intergenic
1054965595 9:71023576-71023598 CAACCCAGATGTCCTTCAACAGG + Intronic
1055199321 9:73639827-73639849 CAACCAAAATGTCCATCAACTGG - Intergenic
1055701531 9:78949938-78949960 CATCCCAGCTGTGCCTAAAGGGG + Intergenic
1055895653 9:81172176-81172198 CAATCCAAATGTCCAGAAACTGG - Intergenic
1056103534 9:83324033-83324055 CAACCCAAATGTTCATCAACAGG + Intronic
1056138520 9:83651797-83651819 CAACCCAAATATCCATGAACTGG - Intergenic
1056267175 9:84909320-84909342 CAACCCAGATGTCCTTCAATAGG - Intronic
1056309946 9:85330343-85330365 CAACCTAAATGTCCATCAACAGG + Intergenic
1056381268 9:86059287-86059309 CAATCCAAATGTCCGTCAACAGG + Intronic
1056404471 9:86260609-86260631 CAACCCAGGTGTCCATTGACAGG - Intergenic
1056705337 9:88947651-88947673 CAAGCCAAATGTCCATCAACAGG - Intergenic
1056736405 9:89213708-89213730 CAACCCAGGTGTCCTTCAACAGG + Intergenic
1057091333 9:92260878-92260900 CAACCCAGATGTCCTTCAAGAGG + Intronic
1057115829 9:92520699-92520721 CAGCCCAGATGTTCATCAACTGG + Intronic
1057117511 9:92539848-92539870 CAACCCAAATGTCCATCAATAGG - Intronic
1057209910 9:93194799-93194821 CAACCCAGATGTCCTTCAGCAGG + Intronic
1057674653 9:97129297-97129319 CAACCCAAATGTCCATCTACTGG - Intergenic
1057728493 9:97587153-97587175 CAACCCAGACGCCCTTCAACAGG - Intronic
1057986568 9:99722284-99722306 AAACCCAGATGTACGTCAACAGG + Intergenic
1058048760 9:100385458-100385480 CAACCCAAATGTTCATCAACAGG + Intergenic
1058103954 9:100949140-100949162 AAACACAGATGTCCCAAAGCTGG - Intergenic
1058230845 9:102422123-102422145 CAACCCAGATGTCCTTCAGCAGG + Intergenic
1058245591 9:102620779-102620801 CAATCCAAATGTCCATCAACTGG - Intergenic
1058822000 9:108741027-108741049 CAACCCAAATGTCCATCCACAGG + Intergenic
1059016787 9:110526772-110526794 CAATCCAGATGTCCTTCAACAGG + Intronic
1059248721 9:112869172-112869194 CAACTCAGCTGTCCCTAAAGAGG - Exonic
1059288915 9:113204010-113204032 CAACTCAAATGTTCATAAACAGG - Intronic
1059526607 9:114996971-114996993 CAAACCAGAAGTCCTTCAACAGG - Intergenic
1060387444 9:123244895-123244917 CAATCCAAATGTCCTTCAACAGG + Intronic
1060495514 9:124115543-124115565 CAACTCAAATGTCCCTTGACAGG + Intergenic
1060773489 9:126349754-126349776 CAACCAAGATGTCCTTCAATGGG - Intronic
1060982042 9:127798535-127798557 CAACCCAAATGTCCATCAATAGG + Intronic
1061011642 9:127959241-127959263 CAACCCAAATGTCCATCAACTGG + Intronic
1061139558 9:128756493-128756515 CAACCCAAATGTCCTTCAACTGG + Intronic
1061301417 9:129707445-129707467 CAACCCACATGTCCTTCAACTGG - Intronic
1061384886 9:130283812-130283834 CAAGCCAGATGTCCATCATCTGG - Intergenic
1061641184 9:131957598-131957620 CAACCCACATGTCTGTAAACAGG + Intronic
1062001043 9:134215813-134215835 CAACCCAGATGTCCCTCAGCTGG + Intergenic
1062301733 9:135877086-135877108 CAACCCAAGTGTCCATCAACAGG + Intronic
1186101264 X:6158970-6158992 CAATCCAGATATCCATAAATAGG + Intronic
1186424523 X:9453505-9453527 CAATCCAGGTGTCCTTCAACTGG - Intergenic
1186477574 X:9869716-9869738 CAACCCAAATGTCAATCAACAGG - Intronic
1186860999 X:13672370-13672392 CAACCCAAATGTCCATTAACTGG + Intronic
1186880362 X:13859471-13859493 CAGCCCAAATGTCCTTCAACTGG - Intronic
1186936345 X:14453783-14453805 CAACACAGATGTCCTTCAATGGG + Intergenic
1186990884 X:15066123-15066145 CAACCCAAATGTCCATTAACTGG + Intergenic
1187226889 X:17381692-17381714 CAACCCAAATGTCCATCATCAGG - Intronic
1187278547 X:17837919-17837941 CCACCCAGATGTCCGTCAGCAGG + Intronic
1187284592 X:17892697-17892719 CAACCCAGATGTCCTACCACAGG + Intergenic
1187406724 X:19010973-19010995 CAACCCGAATGTCCATGAACTGG + Intronic
1187465326 X:19521595-19521617 CAACCAAGATGTCCTTCAAATGG - Intergenic
1187513910 X:19948294-19948316 CAACCCAAATGTCCATCAACTGG + Intronic
1187578624 X:20584837-20584859 CAACTCAGATGTCTATCAACAGG + Intergenic
1187802980 X:23085559-23085581 CAACCCAAATGTTCATCAACTGG - Intergenic
1187911261 X:24113283-24113305 CAACCAAGATGTCCTAAAATAGG - Intergenic
1187946909 X:24434929-24434951 CAACCCAAATGTCCATCAACTGG + Intergenic
1188099420 X:26065069-26065091 CCACCCAAATGTCCATTAACAGG + Intergenic
1188241896 X:27802744-27802766 TAACCCAGATGTCCATCAATAGG - Intergenic
1188698353 X:33226311-33226333 CAACCCAGATGTCCTTCAACAGG + Intronic
1188969333 X:36594203-36594225 CAACCCAAATGTCCAACAACTGG - Intergenic
1189140089 X:38595020-38595042 CAACCTAAATGTCCATAAATAGG - Intronic
1189565914 X:42240926-42240948 CAACCCAGATGTCCTTTGACTGG + Intergenic
1189607093 X:42690504-42690526 TAACCCAGATGTCCATCAGCTGG + Intergenic
1189923013 X:45922095-45922117 CAACCTAAATGTCCGTTAACTGG - Intergenic
1189938376 X:46093870-46093892 CAATCCAAATGTCCTTAAATAGG + Intergenic
1189977014 X:46471862-46471884 CAACCAAGATGTCCTTCAATAGG - Intronic
1189981945 X:46519832-46519854 CAACCTAGATGTCCTTCAACAGG + Intronic
1190124981 X:47696589-47696611 CAACCCAAATGCCCATCAACAGG - Intergenic
1190424177 X:50316374-50316396 CAACCCAAATGTCCTTCAATAGG - Intronic
1190436083 X:50427093-50427115 CAACCAAGATGTCCTTCAATAGG + Intronic
1190534823 X:51415900-51415922 GAACCCAAATGTCCTTCAACAGG - Intergenic
1190599560 X:52076342-52076364 CAACCCAAGTGTCCATCAACAGG + Intergenic
1190609264 X:52177731-52177753 CAACCCAAGTGTCCATCAACAGG - Intergenic
1190989506 X:55531605-55531627 CAACCCAAATGTCCATCAACAGG - Intergenic
1191726855 X:64290855-64290877 CAACCCAGATGTCCTTCAACAGG - Intronic
1192131034 X:68550299-68550321 CAACACAAATGTCCTTTAACTGG - Intergenic
1192270777 X:69577346-69577368 CAACCCAGATGTACTTCAATGGG - Intergenic
1192302685 X:69922203-69922225 CAACCAAGATGTCACTTAATAGG - Intronic
1192569303 X:72189824-72189846 CAACCCAGCTGTCCTTCAACAGG - Intronic
1192771765 X:74200272-74200294 CAACCAAGATGTCCCTCTATAGG + Intergenic
1192806821 X:74518019-74518041 CAACCCAAATGTACTTCAACTGG - Intronic
1192823640 X:74670891-74670913 CAACCCAAATGCCCATTAACAGG + Intergenic
1192899824 X:75484810-75484832 CAAACCAAATGTTCCTAAACTGG + Intronic
1193049198 X:77083184-77083206 AATCCCAGATATCCCTAAAGTGG + Intergenic
1193097944 X:77573910-77573932 CAACTCAAATGTCCCTCAAGTGG + Intronic
1193174327 X:78374570-78374592 CAACCCAGATGTCTTTTAGCTGG - Intergenic
1193373587 X:80730314-80730336 CAACCCAAATGTCCATCAACGGG + Intronic
1193376969 X:80772833-80772855 CATCCCAGATGTCCTTCAATTGG + Intronic
1193570416 X:83134710-83134732 CAACCTAGATGCCCATCAACAGG + Intergenic
1193646642 X:84078528-84078550 CAACACAAATGTCCATCAACAGG + Intronic
1194369253 X:93050535-93050557 CAACCAAGATGTCCTTAAGTAGG - Intergenic
1194587742 X:95757108-95757130 CAACCCAAATGTCCTTAATTTGG + Intergenic
1194632978 X:96309534-96309556 CAACCAAGATGTCTCTCAATAGG + Intergenic
1194960655 X:100231692-100231714 CAACCCAAATGTCCCTCAATAGG + Intergenic
1195071096 X:101280709-101280731 CAACCCAGATGTCCTTCAAAGGG + Intronic
1195082113 X:101381204-101381226 CAACCTAAATGTCCATCAACAGG - Intronic
1195315383 X:103672503-103672525 CAAGCCAGATGTCCCTGGATGGG + Intergenic
1195534732 X:105998517-105998539 CAACCTAGATGCCCATAAACAGG + Intergenic
1195637896 X:107138894-107138916 CAGCCCAGATGTCCTGCAACAGG + Intronic
1195640276 X:107166661-107166683 CAACCTATATGTCCATCAACAGG + Intronic
1195682298 X:107556866-107556888 CAACCCAAATGTTCATCAACAGG - Intronic
1195745693 X:108115639-108115661 CAACCCAAATGTCCATCAACAGG - Intronic
1195796705 X:108656402-108656424 CAACCCAAAAGTCCATCAACAGG - Intronic
1195819192 X:108924647-108924669 CAACCTAGATGTCCTTCAATGGG - Intergenic
1195864998 X:109422859-109422881 CAACCCAAATGTCCATCAGCAGG + Intronic
1196078308 X:111602032-111602054 CTACCCAGATGTCCATCAACAGG - Intergenic
1196284720 X:113865622-113865644 CAATCCAAATGTCCATCAACTGG + Intergenic
1196309867 X:114151229-114151251 CAACCTAAATGTCCATCAACGGG + Intergenic
1196383215 X:115117536-115117558 CAACCCAAATGTCCATCAGCAGG + Intronic
1196440789 X:115718172-115718194 CAACCCAAATGCCCATGAACTGG - Intergenic
1196545246 X:116956059-116956081 CAACCCAAATGTCTCTCAATAGG + Intergenic
1196806818 X:119595534-119595556 CAGCCCAGATGTCCTTCAACAGG + Intronic
1197059185 X:122156297-122156319 CAACTCAAATGTCCTTTAACTGG + Intergenic
1197230301 X:123996796-123996818 TAACCCAAATGTCCTTCAACTGG - Intronic
1197251491 X:124220553-124220575 CAACCCAAATGTCCATCAGCTGG - Intronic
1197307177 X:124857339-124857361 CAATCCAAATGTCCATCAACTGG + Intronic
1197452177 X:126633004-126633026 CAACCTAAATGTCCATCAACAGG - Intergenic
1197500922 X:127241800-127241822 CAATCCAGATGTCCATAAACTGG - Intergenic
1197616768 X:128700869-128700891 CAACCCAAATGTCCATTGACAGG - Intergenic
1197619240 X:128728649-128728671 CAACTCAAATATCCCTCAACAGG - Intergenic
1197683382 X:129410931-129410953 CAACTCAAATGTCCATCAACTGG + Intergenic
1197842027 X:130758514-130758536 CAACCCAGATGTCCTTCAATGGG - Intronic
1197866119 X:131019106-131019128 CAACCCAAATGTTCATCAACAGG - Intergenic
1197878054 X:131132635-131132657 CAACCCAGGTGTTCTTCAACAGG - Intergenic
1197925354 X:131641439-131641461 CAACCCAAATGTCCTTCAATAGG + Intergenic
1198124955 X:133634421-133634443 CAATCCAAATGTCCATCAACTGG + Intronic
1198318482 X:135494338-135494360 CCACCCAAATGTCCATGAACAGG + Intergenic
1198324878 X:135559541-135559563 CAACACAGATGTCCTTCAACAGG - Intronic
1198367555 X:135957191-135957213 CAACCAAGATGTCCTTCAATAGG + Intergenic
1198738523 X:139814478-139814500 CAACCCAAATGTCCATCAGCTGG + Intronic
1198817324 X:140605995-140606017 CAACCCAGATGTCCTTCAACAGG - Intergenic
1199073540 X:143505418-143505440 CAGCCCAGATGTCCTTCACCTGG + Intergenic
1199369173 X:147025256-147025278 CAACCCAGATTTCCCTTAATAGG - Intergenic
1199416771 X:147593551-147593573 CAATCAAGATGTCCTTCAACAGG + Intergenic
1199422921 X:147666604-147666626 CATCCCAGATGTTGCAAAACTGG - Intergenic
1199495179 X:148444748-148444770 CAACTCAAATGTCCATCAACTGG + Intergenic
1199568103 X:149238528-149238550 CAACTCAAATGTCCCTCAATAGG + Intergenic
1199607766 X:149589999-149590021 CAACCAAGATGTCCTTGAAGAGG - Intergenic
1199631357 X:149779368-149779390 CAACCAAGATGTCCTTGAAGAGG + Intergenic
1199660060 X:150039962-150039984 CAACCCAAATGTCCTCAAATGGG + Intergenic
1199712723 X:150482103-150482125 CAACCCAAATGTCCATCAGCTGG + Intronic
1199748256 X:150789938-150789960 CAACCAAGATGTCCTTCAGCAGG + Intronic
1199821638 X:151455203-151455225 CAACTCAAATGTCCATGAACTGG - Intergenic
1199945372 X:152661411-152661433 CAACCAAGATGCCCCTCAATAGG + Intergenic
1199964111 X:152804746-152804768 CAACCCAAATGTCTGTTAACAGG + Intergenic
1200050378 X:153426407-153426429 CAACCCAAATGTCCATCAACAGG - Intergenic
1200132449 X:153858247-153858269 CAACCCACACGTCCATCAACGGG + Intergenic
1200314936 X:155122595-155122617 CAACCCAGATGTCCTACAACAGG + Exonic
1200677449 Y:6166760-6166782 CAACCAAGATGTCCTTAAGTAGG - Intergenic
1201239117 Y:11941250-11941272 CAACCCAGGTGTCCATCAACAGG + Intergenic
1201497355 Y:14602701-14602723 CAATCCAGATATCCATAAATAGG - Intronic
1202275435 Y:23114003-23114025 CAGCCCAGATGTCCATCAAGAGG + Intergenic
1202290593 Y:23306688-23306710 CAGCCCAGATGTCCATCAAGAGG - Intergenic
1202428427 Y:24747722-24747744 CAGCCCAGATGTCCATCAAGAGG + Intergenic
1202442364 Y:24922367-24922389 CAGCCCAGATGTCCATCAAGAGG - Intergenic