ID: 1158374719

View in Genome Browser
Species Human (GRCh38)
Location 18:56849965-56849987
Sequence TGTGTCATGGTGAATGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158374719_1158374724 27 Left 1158374719 18:56849965-56849987 CCCTTCACATTCACCATGACACA 0: 1
1: 0
2: 2
3: 17
4: 220
Right 1158374724 18:56850015-56850037 GAATGTGGCCTTCATGAATGTGG 0: 1
1: 0
2: 4
3: 20
4: 192
1158374719_1158374723 12 Left 1158374719 18:56849965-56849987 CCCTTCACATTCACCATGACACA 0: 1
1: 0
2: 2
3: 17
4: 220
Right 1158374723 18:56850000-56850022 TTTTTTTTGTTTCATGAATGTGG 0: 1
1: 2
2: 14
3: 227
4: 2567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158374719 Original CRISPR TGTGTCATGGTGAATGTGAA GGG (reversed) Intronic
901558652 1:10051979-10052001 TGTGTCATGTTTAATTAGAAAGG - Intronic
902410608 1:16209720-16209742 TGTGTCTGTGTGCATGTGAAGGG - Intronic
902770905 1:18645102-18645124 TGTGTCTGGGTGTTTGTGAATGG + Intronic
905580470 1:39080451-39080473 TGTCTCCTGGTGACTGTGCAAGG - Intergenic
908920117 1:69180125-69180147 TGAGTTATGGTGAAGGTGGAGGG - Intergenic
912690842 1:111803557-111803579 TGTGTGATGGTGAATATCAGAGG - Intronic
914389013 1:147201430-147201452 TCTGGCTTGGTGAAAGTGAAAGG - Exonic
917480176 1:175404972-175404994 TGTCTCAGGGTGAATGTGTCAGG + Intronic
918389950 1:184049054-184049076 TAGGTCTTGGTGATTGTGAATGG - Intergenic
921961633 1:221041191-221041213 TTTGTCAGGGTGAATGGGACTGG + Intergenic
922088625 1:222374613-222374635 GGTTTCATGATGCATGTGAAAGG - Intergenic
924668908 1:246103227-246103249 TTTGTCTTGGGGAATGTGATGGG - Intronic
1063151340 10:3339383-3339405 TGTGACATGGTGGAGGTTAATGG - Intergenic
1063407112 10:5806904-5806926 TGGGTCATGCTTAGTGTGAAAGG - Intronic
1063832874 10:9976325-9976347 TGTTTTTTGGTGATTGTGAATGG - Intergenic
1064500338 10:15964733-15964755 TGTTTCATGGTGAAAGTTTATGG + Intergenic
1066301465 10:34101259-34101281 TGTGTCATGGGGTCTCTGAAGGG - Intergenic
1066369411 10:34807501-34807523 GGAGTCATGGAGACTGTGAATGG - Intronic
1069905877 10:71731806-71731828 TGTGTTAAGGTCAATGTGGATGG - Intronic
1070428495 10:76312849-76312871 TCTGTCATGGCTACTGTGAAGGG + Intronic
1071453850 10:85826598-85826620 TGTGGCAGGGTGAATGTGGCAGG - Intronic
1074278348 10:112026113-112026135 TGTGCCATGGTGAATTTGTAAGG - Intergenic
1074290029 10:112131477-112131499 GGTGTCAGGGTGAGTGAGAAAGG - Intergenic
1076192433 10:128492071-128492093 TGTGTCATGGTGACCCTGGATGG - Intergenic
1076901294 10:133339494-133339516 TGTGTGAGGGTGTATGTGCATGG - Intronic
1077293313 11:1810883-1810905 TGCGTCATGCTGAGTGAGAAAGG + Intergenic
1078040548 11:7858470-7858492 TGTGTTATGGTTAATCAGAACGG - Intergenic
1078491214 11:11770646-11770668 TGTGCCATGGTCATTGTGAGTGG - Intergenic
1079541002 11:21574504-21574526 TCTCTCATGGTGACTATGAAGGG - Intronic
1081771608 11:45653563-45653585 TGCCCCATGGTGAATGTGAATGG + Intronic
1084648599 11:70474950-70474972 TGTGACATCGTGACCGTGAATGG + Intronic
1084766807 11:71315473-71315495 TGTATGATGTTGAATGGGAATGG + Intergenic
1086434648 11:86769535-86769557 TGTGCCATGGGGAATGTGATGGG - Intergenic
1086458582 11:86983430-86983452 TGTGTCAAGGTGAGGGTTAATGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087971583 11:104491025-104491047 TGTGTTTTTGTGAATGTGGAGGG + Intergenic
1088232941 11:107691535-107691557 TGTAGGATTGTGAATGTGAAGGG + Intergenic
1091631998 12:2169046-2169068 TGTGTCATGCTGAAGGCGAGCGG - Intronic
1092835863 12:12487737-12487759 TCTGACATTTTGAATGTGAAGGG - Intronic
1093140436 12:15504327-15504349 TTTGTTATGGCTAATGTGAAAGG - Intronic
1095699350 12:45175044-45175066 TGTGTAGTGGTATATGTGAACGG + Intergenic
1095781652 12:46066954-46066976 AGTGGCATGGTGAAGGTGAAAGG - Intergenic
1096631080 12:52927199-52927221 TGAGTGGTGGTGAAGGTGAAGGG - Intronic
1096883523 12:54693527-54693549 TGCTTCCAGGTGAATGTGAAGGG + Intergenic
1098872596 12:75833781-75833803 TGTGGCATGGGGAAGGTAAATGG + Intergenic
1099103582 12:78473494-78473516 TGTAGCATGGTAAATGTGTAGGG - Intergenic
1101318294 12:103649892-103649914 TTTGTCATGGGGAAGGTGAAAGG - Intronic
1101774287 12:107779509-107779531 AGTATCATTGGGAATGTGAAGGG + Intergenic
1102057076 12:109904668-109904690 TGTGTCATCCAAAATGTGAATGG + Intronic
1102996931 12:117358571-117358593 TCTGTGATGATGTATGTGAAAGG - Intronic
1103205083 12:119122662-119122684 TGTGTGAGCATGAATGTGAATGG + Intronic
1104370169 12:128217328-128217350 TGTGTGAGGCTGTATGTGAAGGG - Intergenic
1104478832 12:129090040-129090062 TGCCTCATCGTGAAGGTGAAAGG - Intronic
1104900948 12:132189272-132189294 TCTGTCATCCTGACTGTGAAGGG + Intergenic
1105256638 13:18747671-18747693 ATTGTGATGGTGAATGTTAAAGG - Intergenic
1106660871 13:31798600-31798622 TTTGTCCTGCTGAATTTGAAAGG - Intronic
1110681262 13:78315039-78315061 TGTGTCATTTTGAGGGTGAAAGG - Intergenic
1115604253 14:34984296-34984318 TGTGCCATGGAGAAAGGGAAAGG + Intronic
1118196270 14:63629667-63629689 TGTGTGATGTTGGATGGGAAAGG + Intronic
1118890655 14:69905730-69905752 TGTGGAAGGGTGAAGGTGAAAGG + Intronic
1120000441 14:79296995-79297017 TCTGTAGTGGTGAATATGAATGG - Intronic
1121255059 14:92525116-92525138 TGTGTCATGGTAGGTGTGTATGG + Intronic
1121371977 14:93367355-93367377 TGTGTCGTGGTAAAAGTGGATGG + Intronic
1121381642 14:93475491-93475513 TGTGTTATGGTGAATGTAAAAGG + Intronic
1126429341 15:48564213-48564235 TGTGTGATGATGAAGGTGATGGG - Intronic
1128548504 15:68583153-68583175 TGGCTCCTGCTGAATGTGAAAGG + Intronic
1129123592 15:73419075-73419097 TGTGACTTGGTGGATGTGACAGG + Intergenic
1129940738 15:79494847-79494869 TGTGTCAGGGTGCAGGTCAAGGG + Intergenic
1133608074 16:7407675-7407697 TGTATTAAGGTGAATGTTAACGG - Intronic
1135149144 16:19990234-19990256 TGTTTCATGGAGAATCTGATTGG - Intergenic
1135716490 16:24773974-24773996 TGTGTCACAATAAATGTGAATGG - Intronic
1137017215 16:35389787-35389809 GCTGCCAGGGTGAATGTGAAAGG + Intergenic
1137027284 16:35489609-35489631 ACTGCCAGGGTGAATGTGAAAGG - Intergenic
1137033644 16:35548236-35548258 ACTGCCAGGGTGAATGTGAAAGG - Intergenic
1137789465 16:51162849-51162871 TGTGTGGTGGTGCATTTGAACGG + Intergenic
1140934027 16:79653995-79654017 TGTGTGTTTGTGCATGTGAATGG + Intergenic
1141647252 16:85374222-85374244 TGTGTCATTGTGCCTGTGCATGG + Intergenic
1141647268 16:85374369-85374391 TGTGTCATTGTGTATGTGTGTGG + Intergenic
1142535111 17:609564-609586 TGTGCCATGCCTAATGTGAAGGG - Intronic
1143745005 17:8986703-8986725 TGTTTCATGGTGAATTTCATTGG + Intergenic
1144121366 17:12156984-12157006 TGTGTCAGGGTGGAGGTGATGGG - Intergenic
1145289834 17:21534390-21534412 TGTGTCATGCAGAAAGGGAAAGG - Exonic
1148117133 17:45182698-45182720 TGTGCCAGGGTGCCTGTGAAAGG + Intergenic
1148340002 17:46867702-46867724 TGTGTGTTGGAGAGTGTGAAAGG + Intronic
1148729991 17:49828221-49828243 AGTGTCTTGGTGAAAGGGAACGG + Exonic
1149458637 17:56809804-56809826 TGTGTGAGGGTGTATGTGTAAGG - Intronic
1149458642 17:56809837-56809859 TGTGTGAGGGTGTATGTGTAAGG - Intronic
1149484121 17:57028659-57028681 ACAGTCATGGTGAAGGTGAAGGG - Intergenic
1150652497 17:67019063-67019085 TGTGTCTTGGTTAATGTGAAAGG - Intronic
1151066504 17:71156758-71156780 TGAGACATGATTAATGTGAAAGG + Intergenic
1151784985 17:76271069-76271091 TGTCTCCTGCTGAATGTGCAGGG + Exonic
1151788732 17:76290202-76290224 TGTCTCCTGGTGACTGGGAAAGG + Intronic
1151838575 17:76600819-76600841 TGTGTGTTTGTGTATGTGAAGGG + Intergenic
1152116509 17:78390906-78390928 TGTCTGATGGTGAATGAGTATGG + Intronic
1153341947 18:3984538-3984560 GGTGACAGGGTGAATGTGAGAGG - Intronic
1154434408 18:14333007-14333029 ATTGTGATGGTGAATGTTAAAGG + Intergenic
1155046253 18:22105972-22105994 TGTGTGTTTGTGTATGTGAAAGG - Intergenic
1155686771 18:28563047-28563069 TGTATCATGCAGAATGGGAAGGG - Intergenic
1158374719 18:56849965-56849987 TGTGTCATGGTGAATGTGAAGGG - Intronic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1160575573 18:79851803-79851825 TGTGTGAATGTGCATGTGAATGG + Intergenic
1163322173 19:16581257-16581279 TGTGTCATGGTGGGGGTGGACGG + Intronic
1165924556 19:39319270-39319292 TGTGTGCTGGTGAGTGTGCAAGG - Intergenic
1165991332 19:39816344-39816366 TGGGACATGGTGAGTGTTAAGGG + Intergenic
1167506773 19:49875074-49875096 TGTCTCATAGTGTAGGTGAAAGG - Intronic
925589422 2:5494470-5494492 TGTCTCTCTGTGAATGTGAAAGG + Intergenic
927078210 2:19601449-19601471 TTTCTCATGATGAATGTGGATGG + Intergenic
927147682 2:20177749-20177771 TGTGTCATGGTGGCTGTGATTGG + Intergenic
927219349 2:20692849-20692871 GGTGTCATGCTGAGAGTGAAAGG + Intronic
928226335 2:29451453-29451475 TGTGTGTAGGAGAATGTGAAAGG - Intronic
929392241 2:41483349-41483371 TGTTTCCTGGTAAATATGAAGGG - Intergenic
929840231 2:45452521-45452543 TTTGTAATGGAGAATGTGATTGG - Intronic
930576769 2:53160051-53160073 CGTATCATGATGACTGTGAAAGG + Intergenic
930628858 2:53730470-53730492 CATGTCTTGGTGATTGTGAATGG + Intronic
932541871 2:72663935-72663957 TGCCTCAGGGTGAAGGTGAAGGG + Intronic
935308879 2:101762922-101762944 TGTGTGGTGGTGAATTTGAGTGG + Intronic
935806974 2:106758847-106758869 TGTTGCATGGTTAATGAGAATGG - Intergenic
937581802 2:123496957-123496979 TGTGTCATGATAAAGGAGAAAGG + Intergenic
937904164 2:127044470-127044492 GGTGTGAGTGTGAATGTGAATGG - Intergenic
938685062 2:133730150-133730172 TGTGTCAGGGTGGACTTGAATGG + Intergenic
938787357 2:134643735-134643757 AGTGTCATGTTGAATAGGAATGG - Intronic
940697864 2:157002557-157002579 TGTTTCATTGTGAACATGAAGGG + Intergenic
944173675 2:196806027-196806049 TGCTTCATGGTGTTTGTGAAAGG - Intronic
944526731 2:200627213-200627235 AGGGTCATGGTGAAAGTGCACGG + Intronic
946954949 2:224919461-224919483 TGTGTCAGTGTGAGTGTGGATGG + Intronic
947060050 2:226154115-226154137 GCTGTAATGGTGAATTTGAATGG - Intergenic
947796891 2:232898979-232899001 TGTGTGAATGTGAGTGTGAATGG + Intronic
1168893337 20:1308143-1308165 TGTGTTTTGGTGGATGTGACAGG + Exonic
1171311978 20:24151941-24151963 TGTGTAATGGTGAGAGTGAGGGG - Intergenic
1173980475 20:47220172-47220194 TTTGTCAGGGAGAATTTGAAGGG - Intronic
1173993468 20:47320337-47320359 TGTGACAAGGTGACTGTGGAGGG - Intronic
1176360132 21:5988264-5988286 TGTGACATGGAGAATAGGAAGGG + Intergenic
1178158553 21:29883678-29883700 TGTGACATTCTGAATGGGAATGG + Intronic
1179202345 21:39236370-39236392 TGTGTCTTGGGGATTCTGAAGGG - Intronic
1179763386 21:43550286-43550308 TGTGACATGGAGAATAGGAAGGG - Intronic
1180053368 21:45344082-45344104 TGTGTCCGTGTGAATGTGAGAGG + Intergenic
1181959588 22:26613240-26613262 TGTGCCTTGGTCCATGTGAATGG - Intronic
1182583628 22:31330014-31330036 TGTGTAATTTTGAAAGTGAATGG - Intronic
1183046576 22:35225512-35225534 TGTGTCAAAGTTTATGTGAATGG + Intergenic
1184310959 22:43642367-43642389 TGTTTCATGTTGTCTGTGAATGG - Intronic
949981152 3:9502385-9502407 TGTGCCCTGGGGAATGTGCAAGG - Intronic
950063966 3:10096318-10096340 CGTGTCCTGGTGAATCTGAATGG - Exonic
951285968 3:20814361-20814383 TGAGTCCTGCGGAATGTGAATGG - Intergenic
951911134 3:27751871-27751893 TGTTTTATGGTACATGTGAATGG - Intergenic
952696118 3:36266731-36266753 TGTGTCTGATTGAATGTGAAGGG - Intergenic
952899676 3:38101681-38101703 TTTGTCATGGTGAAAGTGTGGGG - Intronic
955651370 3:61197777-61197799 TGTGTCATGGGGATTGTTAAGGG - Intronic
955942554 3:64159956-64159978 CCTGTCATGGTGACTGGGAAAGG + Exonic
958668160 3:97167056-97167078 TGTGTCTTATTGAATATGAATGG - Intronic
958977033 3:100679996-100680018 TGTGTCAAAGTGATTGTTAAAGG + Intronic
960421361 3:117449751-117449773 TGTGTGTTTGTGTATGTGAAAGG + Intergenic
960806171 3:121585902-121585924 AGTGTCATGGTGAATTAGAGAGG + Intronic
963871132 3:150415236-150415258 TGTGTCACTGTGAATATAAAAGG - Intronic
966286681 3:178304793-178304815 TGTACCATGGTGACTGTCAAGGG + Intergenic
967436344 3:189451184-189451206 TTTCTTCTGGTGAATGTGAAAGG - Intergenic
969095902 4:4732501-4732523 TGGGTCATATTGTATGTGAATGG + Intergenic
970246071 4:14065125-14065147 TGTCCCATTATGAATGTGAATGG - Intergenic
971385022 4:26134482-26134504 TGTCTCATGGAGAAAGTGTAAGG + Intergenic
971777233 4:30982240-30982262 TGTGCCAAGGGGAGTGTGAAGGG + Intronic
972224788 4:37000343-37000365 GGCTTCATGGAGAATGTGAATGG - Intergenic
972669985 4:41206036-41206058 TTGGTCATGGTGACTGTGGAGGG - Intronic
972792033 4:42382033-42382055 TGTGTAATGTTCAGTGTGAAGGG + Intergenic
973259289 4:48145121-48145143 TGTGTCAGGATGTGTGTGAAGGG - Exonic
973958259 4:56085050-56085072 TGTGTGATTGTGAGTGGGAAGGG + Intergenic
975373527 4:73615278-73615300 TGAATCATGGTGAATGGGAATGG - Intronic
976816686 4:89156393-89156415 TGTCACATGGAGAATGTCAAAGG + Intergenic
980489269 4:133504952-133504974 TAGGTGATGGTGAGTGTGAAAGG + Intergenic
980755127 4:137148564-137148586 TGTGTCCTAGTGTTTGTGAAAGG - Intergenic
983551505 4:169021979-169022001 TGAGTCTTGGTGAATGAGAAAGG + Intergenic
983803620 4:171966360-171966382 TGAGTCTTGGTGAATGAGAGTGG + Intronic
984501730 4:180566253-180566275 TGTGTGAGGGTGAGTGTGACTGG + Intergenic
987761273 5:22165279-22165301 TCTGTCATGGAGAAAGTGAAGGG - Intronic
991896062 5:71398733-71398755 CCTGTCATGGAGAAAGTGAAGGG - Intergenic
993027570 5:82664014-82664036 TCTGTGAAGGTGAAAGTGAATGG + Intergenic
993078615 5:83268154-83268176 GGTGTAATAGTGAATGTGATTGG + Intronic
995939127 5:117557381-117557403 TGTGTCGTGGTGAATATGCTGGG - Intergenic
996424359 5:123297272-123297294 TGTGCAATGATGTATGTGAAAGG - Intergenic
1000448761 5:161358338-161358360 GGTGTCATGGTGGAAGGGAAAGG + Intronic
1000599478 5:163254529-163254551 TGGGACTTTGTGAATGTGAATGG - Intergenic
1003257110 6:4484158-4484180 TGTGTGATGGTGAATTTTATGGG - Intergenic
1005842960 6:29756276-29756298 TGTGTCTGTGTGAATGTTAATGG + Intergenic
1006798210 6:36744108-36744130 TGTGTCTGGGTGAGTGTGCAGGG - Intronic
1007172599 6:39874501-39874523 TGTTCCATGGGCAATGTGAATGG + Intronic
1007501973 6:42305312-42305334 GGTGGCATGGTGGATGTGACAGG - Intronic
1007846472 6:44761607-44761629 TGTGTCTTTGTGAATGAAAAAGG + Intergenic
1008303197 6:49868684-49868706 TCAGTCATGGAGAAAGTGAAGGG - Intronic
1008696441 6:54043841-54043863 TGTGTCATGGTGACAGTGTGTGG + Intronic
1013360845 6:109392641-109392663 TCTGTCATAGAGACTGTGAAAGG - Intronic
1014811781 6:125894602-125894624 TCTGTGATGATGAATGTGTAAGG - Intronic
1015159752 6:130139434-130139456 TGTGTCATTGTGGATAAGAAAGG + Intronic
1015201857 6:130591842-130591864 TGTGATATGGTATATGTGAAGGG - Intergenic
1015218056 6:130772988-130773010 TGTGAGATGATGAATGGGAAGGG - Intergenic
1021278358 7:18684570-18684592 TGTGTCCTAATGAGTGTGAATGG + Intronic
1022957460 7:35394398-35394420 TGTGTCATCTTGAAAGTCAATGG + Intergenic
1024069726 7:45775610-45775632 TGGGTCTTGGTGAGTGGGAAGGG - Intergenic
1024515921 7:50255944-50255966 TGTGTCAATGTCAATGTCAATGG - Intergenic
1024951135 7:54861489-54861511 TGTGTCTTGAAGAATGTGCATGG + Intergenic
1025835051 7:65086068-65086090 TGGGTCATGGTGAGTGGGAGGGG - Intergenic
1025904824 7:65775547-65775569 TGGGTCATGGTGAGTGGGAGGGG - Intergenic
1026608698 7:71838168-71838190 TCTGCCATGGTTAATATGAATGG + Intronic
1027975551 7:85149691-85149713 TCTGACATGGTGGAAGTGAATGG - Intronic
1030521116 7:110599273-110599295 TGTGTCATATTGGATGTGAAAGG - Intergenic
1032490408 7:132320053-132320075 TGTGTCATGCTGACTTTCAAGGG - Intronic
1033765608 7:144486936-144486958 TGTGTCTTGGTAAATGGGTAAGG - Intronic
1038307323 8:26416668-26416690 TGTTTTATGGTGTCTGTGAATGG + Intronic
1040102948 8:43521269-43521291 TTTGTCATTGGGAATGTTAAAGG + Intergenic
1040941657 8:52840148-52840170 TTTGTAAAGGTGAATGTCAAAGG - Intergenic
1042691133 8:71500014-71500036 ACTGTCAGGGTGAATGGGAAAGG + Intronic
1043083955 8:75803671-75803693 TATGTCACTGTGAATGAGAAAGG - Intergenic
1044944309 8:97376443-97376465 AGTGGCATGGAGAATGTAAATGG - Intergenic
1045917925 8:107495179-107495201 TTTGTCATTGTCAATGTGATTGG - Intronic
1047219409 8:122907570-122907592 TTTCTCATTTTGAATGTGAAGGG - Intronic
1047416783 8:124671139-124671161 CCTGTCATGGTGGATGTGGAAGG - Intronic
1047454488 8:124997379-124997401 TGTGACTTGGTGAAGGTCAATGG + Intergenic
1048087793 8:131202807-131202829 TGAGTCATGGTGACAGTGAATGG - Intergenic
1049323157 8:142008026-142008048 TGTGTCCGGGTGTATGTGATGGG - Intergenic
1049525439 8:143123556-143123578 TGTGTCATGGTGTATGTGTGTGG - Intergenic
1050155071 9:2658159-2658181 TGTGTGAAGGTAGATGTGAAAGG - Exonic
1051922670 9:22286371-22286393 TGTAGCATGGTGATTATGAAGGG + Intergenic
1053144701 9:35704511-35704533 TGTCACATGGTGACTGTGGAAGG + Intronic
1055271295 9:74562584-74562606 TGGGTCATGGTGAAGGAGTAGGG - Intronic
1056838607 9:89979196-89979218 TATGTCATGGTTATTGTAAATGG - Intergenic
1057483447 9:95463349-95463371 TGTGTCAGGGTGAGCGTGGAGGG + Intronic
1058335021 9:103816336-103816358 TGTGTCAAGATGAAAGTAAATGG + Intergenic
1058793301 9:108472494-108472516 TTTGTCTTGTTGAATGTGGATGG - Intergenic
1185584182 X:1232968-1232990 AGGGGCATGGTGAATGAGAAGGG + Intergenic
1185863853 X:3604995-3605017 TGTGTCTTGGTGAAGGTGAGGGG - Exonic
1186478019 X:9873819-9873841 TGTGTCGTGGTAAATGTGGGAGG - Intronic
1187017610 X:15345852-15345874 TGTTTTTTGGTGAATGAGAAAGG - Exonic
1187030428 X:15482002-15482024 TGTGTTAATGTGATTGTGAATGG - Intronic
1187792614 X:22967559-22967581 TGTGTGATGGGGGATGTGAGTGG - Intergenic
1189752087 X:44232548-44232570 GGAGTCACGGTGAATGTGAATGG - Exonic
1190841741 X:54151862-54151884 TGTGTACTGAAGAATGTGAAAGG + Intronic
1192298746 X:69878698-69878720 TGTGTCTTGGTGAAGGTGAGGGG - Intronic
1198078577 X:133217384-133217406 TGTGTCATCGTGGATTTCAAAGG + Exonic
1198656377 X:138917948-138917970 TGAGTTATGATGAATCTGAAAGG + Intronic
1200367328 X:155680855-155680877 TCTGTTATGGTGATTGTGATCGG + Intergenic
1201784199 Y:17756680-17756702 TGTGGCTTGGTGAGTGTGCATGG - Intergenic
1201817354 Y:18149307-18149329 TGTGGCTTGGTGAGTGTGCATGG + Intergenic
1202041875 Y:20694330-20694352 TCAATCATGGTGAATCTGAAAGG + Intergenic