ID: 1158380121

View in Genome Browser
Species Human (GRCh38)
Location 18:56920270-56920292
Sequence GGGGCTATAAGAAGGCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158380121 Original CRISPR GGGGCTATAAGAAGGCTTCC AGG (reversed) Intronic
901737996 1:11324472-11324494 GGGGGGACAGGAAGGCTTCCTGG + Intergenic
902652374 1:17845065-17845087 GGGGCTTTGAGGAGGCTTCCTGG + Intergenic
903300068 1:22372441-22372463 TGGGCTTTAACAAGTCTTCCAGG + Intergenic
903368508 1:22819422-22819444 GGGGGTACCAGGAGGCTTCCAGG - Intronic
903447648 1:23432496-23432518 GTTGGTTTAAGAAGGCTTCCTGG - Intronic
903999971 1:27333370-27333392 TGGGGTGTGAGAAGGCTTCCTGG - Intronic
904817512 1:33216645-33216667 GGGAGTCAAAGAAGGCTTCCTGG + Intergenic
905923880 1:41736414-41736436 GGGGCCCTGACAAGGCTTCCTGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
905953711 1:41974681-41974703 GGGGGTTCAGGAAGGCTTCCTGG - Intronic
906824772 1:48967611-48967633 GGTGCCAAAAGAACGCTTCCTGG + Intronic
906943977 1:50279883-50279905 GAGGGTCAAAGAAGGCTTCCTGG - Intergenic
907372792 1:54013972-54013994 GGGGGTCTAGGAAGGCATCCTGG + Intronic
907393952 1:54176870-54176892 GGGGCTCTAGGAAAGCTTCCAGG + Intronic
912698159 1:111856620-111856642 GGGGCTGGCAGCAGGCTTCCTGG - Intronic
914728496 1:150349794-150349816 GGTTCTCTAAGAAGGCTTCAGGG - Intronic
917499913 1:175576793-175576815 GGGGGTTTAAGAAGGCTTCATGG - Intronic
918420477 1:184359746-184359768 GGGACTTAAGGAAGGCTTCCAGG - Intergenic
918893818 1:190314259-190314281 GGGAGTAAAAGAAGGTTTCCTGG + Intronic
921822532 1:219634046-219634068 GAGGGTAAGAGAAGGCTTCCTGG + Intergenic
923538844 1:234873797-234873819 TGGGGTATAGGAGGGCTTCCTGG - Intergenic
924781086 1:247148282-247148304 GGGCTTATGAGAAGGCTTCCTGG - Intronic
924830648 1:247591003-247591025 GGAGCTAACTGAAGGCTTCCTGG + Intergenic
1062812068 10:474484-474506 GGGGCTCCAAGAGGACTTCCAGG - Intronic
1064547408 10:16464714-16464736 GGAGGAATGAGAAGGCTTCCTGG - Intronic
1066198707 10:33126258-33126280 TGGGCTGAAAGCAGGCTTCCGGG + Intergenic
1070735747 10:78862420-78862442 GGGCATCTGAGAAGGCTTCCTGG + Intergenic
1071571897 10:86701657-86701679 GTGGATCAAAGAAGGCTTCCTGG + Intronic
1073290742 10:102412068-102412090 GGGGCTCAAAGGAGGCATCCTGG + Intronic
1074107278 10:110398050-110398072 GGGACCTTAGGAAGGCTTCCTGG - Intergenic
1075077796 10:119362734-119362756 GGGGCTATAATAAGGCTCCAAGG - Intronic
1078328325 11:10398286-10398308 GGGTCTACAGGAAGGCTCCCTGG + Intronic
1081633005 11:44702049-44702071 GGGTGTTTGAGAAGGCTTCCCGG - Intergenic
1083553792 11:63609967-63609989 GGGGCTCTTATAAGGATTCCAGG - Intronic
1083622249 11:64055050-64055072 GGGGATCTAGGAAGGCTTCCTGG - Intronic
1083652649 11:64212107-64212129 GGAGCTCTGGGAAGGCTTCCTGG + Intronic
1083940800 11:65894417-65894439 TGGGGAATAAGACGGCTTCCTGG - Intronic
1085719274 11:78898630-78898652 GGGGAGAAAGGAAGGCTTCCTGG - Intronic
1086720255 11:90111854-90111876 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1092925770 12:13270776-13270798 GGGACTTTGAGAAGGCTTCAGGG - Intergenic
1094500979 12:31020590-31020612 GGTGCTCAGAGAAGGCTTCCTGG + Intergenic
1095493041 12:42756351-42756373 GGGGATATCAGAAGCCTTCTGGG + Intergenic
1098287500 12:68922130-68922152 GGGAATAGAAAAAGGCTTCCTGG + Intronic
1099960337 12:89391129-89391151 TGGGGTGTCAGAAGGCTTCCTGG + Intergenic
1100998758 12:100332655-100332677 GGGGGTATAAGGAAGCTTCTGGG + Intronic
1102719792 12:115006164-115006186 GGGGATAATATAAGGCTTCCTGG + Intergenic
1103176742 12:118870721-118870743 GGGGCGAAAACAATGCTTCCTGG + Intergenic
1103361351 12:120356259-120356281 GGGGCAAAAGGAAGGCTGCCTGG - Intronic
1103888454 12:124220730-124220752 GAGGCTTTAGGAAGGCTCCCTGG + Intronic
1105643009 13:22285661-22285683 CGGGCTCTGGGAAGGCTTCCTGG + Intergenic
1106347391 13:28892289-28892311 TGAGGTATAGGAAGGCTTCCTGG + Intronic
1107894817 13:44950764-44950786 GGGGCTACAACTAGGCTTGCTGG - Intronic
1108093620 13:46877790-46877812 GGGGAAATGTGAAGGCTTCCTGG + Intronic
1108788869 13:53942056-53942078 GAGGCAATAAGAAGCCTTCCTGG - Intergenic
1112195025 13:97217467-97217489 GGTGGTCAAAGAAGGCTTCCTGG + Intergenic
1112512729 13:100024210-100024232 GGGTCTGTAAGATGGCTTCATGG - Intergenic
1114666489 14:24380287-24380309 GGGGCTATAAGAAGGGATTGCGG + Intergenic
1119905049 14:78294062-78294084 GGGACTATAAAGAGGGTTCCAGG - Intronic
1120577148 14:86196752-86196774 CTGGCTATTAGAAGGCTCCCTGG - Intergenic
1121611298 14:95282697-95282719 GGGGTAATATAAAGGCTTCCTGG - Intronic
1122523790 14:102365345-102365367 GGGAATTTATGAAGGCTTCCTGG + Intronic
1202934412 14_KI270725v1_random:72048-72070 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1123668775 15:22631885-22631907 GGGGCTTTAAGAAGTCATGCAGG - Intergenic
1123728035 15:23124096-23124118 GGGGCTACAGGCTGGCTTCCGGG + Intergenic
1124002547 15:25770966-25770988 TGGGTTAAATGAAGGCTTCCAGG + Intronic
1124524748 15:30438365-30438387 GGGGCTTTAAGAAGTCATGCAGG - Intergenic
1124773905 15:32569348-32569370 GGGGCTTTAAGAAGTCATGCAGG + Intergenic
1125590733 15:40853287-40853309 GGGGCTCCAAGAAGGCTGGCAGG - Intronic
1128473993 15:67981514-67981536 GGGGATCAGAGAAGGCTTCCTGG - Intergenic
1129303344 15:74639835-74639857 GGGGCAATAATATGGCTTACTGG + Intronic
1130876242 15:88017294-88017316 GGAGCTGTATGAAGGGTTCCTGG - Intronic
1132224428 15:100129438-100129460 GGCGCTATAAGAAGTCATGCTGG + Intronic
1132370523 15:101294887-101294909 GGCGCTAACAGAAGGCTCCCAGG + Intronic
1132654555 16:1036463-1036485 GGGGGAGGAAGAAGGCTTCCTGG - Intergenic
1133034957 16:3029357-3029379 GGGGCTCTAAGATCTCTTCCGGG + Exonic
1133248803 16:4466590-4466612 GTGGCTGGTAGAAGGCTTCCGGG - Intronic
1134212618 16:12290398-12290420 GGTGATTTGAGAAGGCTTCCAGG - Intronic
1134263950 16:12676639-12676661 GGCCCTGTAAGAAGGCTTCCTGG + Intronic
1134805266 16:17118820-17118842 GTGGCTAAAACAAGGCATCCTGG - Intronic
1135397354 16:22141449-22141471 GGGGCTCCAAGATGGCTTCAAGG - Intronic
1136043661 16:27599535-27599557 GGGTCTATAAGGATGATTCCAGG - Intronic
1138553720 16:57760493-57760515 GGGGCCGTCAGAAGGCTTCCTGG + Intronic
1138728500 16:59167435-59167457 GGGACTGGAAGAAAGCTTCCAGG - Intergenic
1139027828 16:62840711-62840733 CTGACTATAAGAAGGCATCCTGG - Intergenic
1139872431 16:70118286-70118308 GGGTCTATAGGAAGGGTTTCAGG + Intronic
1140363341 16:74363013-74363035 GGGTCTATAGGAAGGGTTTCAGG - Intergenic
1141310652 16:82910618-82910640 TGTCCTATAAGAAGGCTCCCAGG + Intronic
1142490250 17:273950-273972 TGGGCCATAAGAAAGCTTCTTGG - Intronic
1143847722 17:9785756-9785778 AGTGCTATAAGATGGCTTCAAGG - Intronic
1145002306 17:19313917-19313939 CAGGCTTTATGAAGGCTTCCTGG + Intronic
1145778446 17:27545697-27545719 AGGGCTTGAGGAAGGCTTCCTGG + Intronic
1146463599 17:33067315-33067337 GGGCATCTGAGAAGGCTTCCTGG + Intronic
1146545696 17:33736175-33736197 GGGGCTATAAAGAGGCCACCTGG + Intronic
1147357915 17:39912037-39912059 GGGGGCATCAGAAGGCTTCCTGG + Intronic
1147672520 17:42184735-42184757 GGGGGTCTCAAAAGGCTTCCTGG - Intronic
1148490187 17:48018453-48018475 GGGACTATGAAAAGGCTTGCAGG - Intergenic
1149498514 17:57134301-57134323 GGGGATAAAAGAAAGATTCCAGG - Intergenic
1150636766 17:66918624-66918646 GGAGCTATAACAAGGCTTTTGGG - Intergenic
1151035304 17:70792192-70792214 GGGGTTAAATGAAGGCTACCAGG + Intergenic
1152000991 17:77645135-77645157 GGGGCAAGAAGAAGGCACCCTGG + Intergenic
1153476344 18:5502748-5502770 GGGGCTAGATGAGAGCTTCCTGG + Intronic
1154490709 18:14919885-14919907 GGGGCTAGAACAGGGCTTGCAGG + Intergenic
1155244447 18:23894034-23894056 TGGGAGATGAGAAGGCTTCCTGG + Intronic
1157634364 18:49135619-49135641 GGAGGTATAAGAAGGCTATCAGG + Intronic
1157676717 18:49574012-49574034 GGGGCAATAAAAAGGTCTCCAGG + Intronic
1158380121 18:56920270-56920292 GGGGCTATAAGAAGGCTTCCAGG - Intronic
1158692780 18:59676058-59676080 GGGGCTATAAGATGACATCTGGG - Intronic
1160168061 18:76530920-76530942 GGGAATCTAAGAAGGCCTCCTGG - Intergenic
1161148696 19:2695290-2695312 GGGGTGATAAGAAGTCGTCCAGG - Intronic
1163171505 19:15534744-15534766 GGGGTTTGGAGAAGGCTTCCTGG + Intronic
1166203529 19:41253848-41253870 GGGGGTCTGGGAAGGCTTCCTGG + Intronic
1166270075 19:41708231-41708253 GGGGCTAGAAAAAGGCTCACTGG - Intronic
1166326072 19:42051912-42051934 GAGGCTGGAGGAAGGCTTCCTGG - Intronic
1166827128 19:45616575-45616597 GGGGCTATGAGGAGGCACCCAGG + Intronic
928414383 2:31079480-31079502 GGGGTTAAATGAAGGCTGCCAGG + Intronic
928813623 2:35260633-35260655 GGGCCTAAACAAAGGCTTCCTGG + Intergenic
930140583 2:47947766-47947788 GGGGATAGAAGAATGCTTCCAGG + Intergenic
931534404 2:63256931-63256953 GTGGGTATAGGAAGGCTTCTGGG + Intronic
931635412 2:64337026-64337048 GGTGACATGAGAAGGCTTCCTGG - Intergenic
934306842 2:91832278-91832300 GAGGCTGGCAGAAGGCTTCCTGG + Intergenic
934326414 2:92020464-92020486 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
934464775 2:94251080-94251102 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
934934143 2:98452399-98452421 TGTGCTTTAAGAAGACTTCCAGG + Intronic
937440848 2:121914490-121914512 GTGGCCATTAGAGGGCTTCCTGG - Intergenic
938790719 2:134673172-134673194 GGGGTTAGTAGAAGGCTGCCAGG - Intronic
939182045 2:138814992-138815014 GGAGCTACAACAGGGCTTCCAGG + Intergenic
940045102 2:149401476-149401498 GGGGCTCACAGAGGGCTTCCTGG - Intronic
941543854 2:166820630-166820652 GGGACTTGAAGAAGGCTTCTGGG + Intergenic
1168813489 20:721319-721341 GGGGCTGGAAGAAGCCTCCCTGG + Intergenic
1169294472 20:4381849-4381871 GGTGCTATAATAATACTTCCTGG + Intergenic
1170038672 20:12017460-12017482 GGGGCTATATGAAGACTCACTGG + Intergenic
1170400125 20:15973103-15973125 GGGGCCATGAGAGGGCTGCCTGG + Intronic
1170768436 20:19311591-19311613 TGGGGTAAAGGAAGGCTTCCAGG + Intronic
1170926144 20:20726177-20726199 GGAGCTCAGAGAAGGCTTCCTGG + Intergenic
1172185733 20:33029953-33029975 GGGGGTTGAGGAAGGCTTCCTGG + Intergenic
1172988026 20:39008868-39008890 GTGGCTGGAAGAAGGCCTCCAGG - Intronic
1173026233 20:39310036-39310058 GGGGTTCATAGAAGGCTTCCTGG - Intergenic
1173875496 20:46368060-46368082 GGTGGGATCAGAAGGCTTCCTGG - Intronic
1176595814 21:8694252-8694274 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1179634934 21:42702876-42702898 GCAGCTATTAGAAGGCTTTCAGG + Intronic
1180169324 21:46049822-46049844 TGGGCTTGAAGAGGGCTTCCTGG + Intergenic
1180278676 22:10671365-10671387 GAGGCTGACAGAAGGCTTCCTGG - Intergenic
1181547298 22:23609407-23609429 GGGGCTGTAAACTGGCTTCCTGG - Intronic
1181601354 22:23953658-23953680 GGGGCTCAGGGAAGGCTTCCAGG - Intergenic
1181607152 22:23987679-23987701 GGGGCTCAGGGAAGGCTTCCAGG + Intergenic
1182481597 22:30612809-30612831 GGTGCTGTAAGCAGGCTTACGGG + Intronic
1183199315 22:36374960-36374982 GGGAGTCTGAGAAGGCTTCCTGG - Intronic
1183739806 22:39663277-39663299 GGGGACATCAGAAGGCTTCCTGG + Intronic
1184414484 22:44344321-44344343 GGGGCTCAGAGAAGGCTTCCAGG - Intergenic
1184477114 22:44727886-44727908 GGGGTTCTGGGAAGGCTTCCTGG + Intronic
1184566506 22:45295207-45295229 GGAGCTGCAGGAAGGCTTCCTGG - Intronic
1185413097 22:50696298-50696320 GGGTCTATAAGAAAGCTTCAGGG - Intergenic
949929960 3:9070942-9070964 GGCACCATAGGAAGGCTTCCCGG + Intronic
954710366 3:52502428-52502450 GGGGCTCACAGAGGGCTTCCTGG - Intronic
961519472 3:127458538-127458560 GGGGGTCAGAGAAGGCTTCCCGG - Intergenic
961567008 3:127771078-127771100 GGGGGTTTAAGCAGGCTTCTGGG - Intronic
961616573 3:128187424-128187446 GGGTTTACAAGAAGGATTCCAGG - Intronic
963745402 3:149119780-149119802 GGGGCTTTCAGAAGCCTACCTGG + Intergenic
964197084 3:154077347-154077369 GGGGCTTCAAGAGGGCATCCTGG - Intergenic
966809468 3:183830495-183830517 GGGGGTAGAGAAAGGCTTCCTGG + Intronic
969156081 4:5211093-5211115 GGGGATATAAGAAGTATTTCTGG - Intronic
969649417 4:8455324-8455346 GGGCCTCTGAGAAGGCTTCTTGG + Intronic
969708845 4:8831248-8831270 GTGCCTCTAGGAAGGCTTCCTGG - Intergenic
970320792 4:14873572-14873594 GAGGCTCCAAGAAGGCTTCAGGG + Intergenic
971342459 4:25783146-25783168 GGGGCCATAAGGGGGCTTCTTGG - Intronic
973046210 4:45536488-45536510 GGGAATAAAAGAAGGCTGCCTGG + Intergenic
973169586 4:47122849-47122871 GGAGCTAGAGGAAGGCTTCAAGG - Intronic
977530787 4:98198517-98198539 GGGCCAATAAGAATTCTTCCTGG - Intergenic
977882104 4:102216853-102216875 GGGGCAATTTGAAGACTTCCTGG + Intergenic
982597056 4:157399736-157399758 GGGGCAGTAAGAAGGATTCTGGG - Intergenic
983832903 4:172352482-172352504 AGGCCTATAACAAGGCTTCATGG + Intronic
985959006 5:3285715-3285737 GGGGCTGGATGAAGGCTTCCGGG - Intergenic
987047089 5:14118546-14118568 GGCTCTAAAAGAAGGATTCCTGG + Intergenic
988017062 5:25572574-25572596 GGGGGTAAAAAAAGGCTTCCTGG + Intergenic
994303991 5:98180351-98180373 GGTACTAGAAAAAGGCTTCCAGG + Intergenic
999276388 5:150333287-150333309 AGGGGTATAAGAATGCTTGCTGG + Intronic
1000052377 5:157574711-157574733 GGGGCTATAAGCAGATTTCGCGG - Intronic
1002877805 6:1226755-1226777 GGGGCAGTAAGTAGGCTGCCGGG + Intergenic
1004459288 6:15820668-15820690 GGGGATTTAAGTAGCCTTCCAGG - Intergenic
1006903682 6:37518889-37518911 GGGGATCTAGGAAGACTTCCTGG - Intergenic
1007075061 6:39060971-39060993 GCGGCATTAGGAAGGCTTCCAGG + Intronic
1007177026 6:39903896-39903918 AGGGCAAGATGAAGGCTTCCAGG + Exonic
1010999379 6:82570655-82570677 CCTGCTTTAAGAAGGCTTCCTGG - Intergenic
1013001901 6:106031376-106031398 GGGGGCAAAAGAATGCTTCCTGG + Intergenic
1015386778 6:132633637-132633659 GGGGATAACAGAATGCTTCCTGG + Intergenic
1016533760 6:145088581-145088603 AGGGCTTTAAGAAGACCTCCAGG + Intergenic
1017185372 6:151595412-151595434 GGGACTGTAAGAAGGTTTCTTGG - Intronic
1018830711 6:167441205-167441227 GGGGCTTTAAAAAGACTTCTAGG - Intergenic
1022004994 7:26259582-26259604 GGGGATTAAAAAAGGCTTCCTGG - Intergenic
1024183893 7:46928168-46928190 TGGGCTGTTACAAGGCTTCCAGG - Intergenic
1024974928 7:55104532-55104554 GGGGTTATCTGAAGGATTCCAGG + Intronic
1025614100 7:63103328-63103350 GGTGATCAAAGAAGGCTTCCTGG - Intergenic
1027132611 7:75601865-75601887 GGGGCTATACCAGGGCTTCTTGG + Intronic
1028987368 7:97018748-97018770 GGGGCAATAGGAAGGTTTGCGGG - Intergenic
1031262355 7:119537168-119537190 CGGTCTATAAGGAGTCTTCCTGG - Intergenic
1035874874 8:3177283-3177305 GGGGCTATAAGAAAGCCTAGGGG + Intronic
1036650002 8:10636197-10636219 GGGTCTATAACAAGAGTTCCAGG + Intronic
1039593718 8:38771635-38771657 TGTGTTATAAGAAGGCCTCCAGG - Intronic
1039929998 8:41977516-41977538 TGCACTATAAGTAGGCTTCCTGG - Intronic
1040294631 8:46142828-46142850 TGGGATAAAAGAAGTCTTCCTGG + Intergenic
1042807949 8:72792197-72792219 CTGGCTACAAGAAGGCATCCTGG - Intronic
1044349094 8:91142567-91142589 TGGGTTTTAAGAAGGCATCCAGG - Intronic
1044404659 8:91814323-91814345 GGAGCTCTAATAAGGTTTCCTGG - Intergenic
1046353323 8:113045626-113045648 GGTGCTAGAAGAAGTCTTCATGG - Intronic
1047619352 8:126590571-126590593 GTGGCCATAAGAAGGCCACCGGG + Intergenic
1047994147 8:130317538-130317560 GAGGCTATAAAAAACCTTCCTGG - Intronic
1048199897 8:132363661-132363683 TGGGCTAAAAGATGGCATCCAGG - Intronic
1049216436 8:141410402-141410424 GGGGCTTTAAGAAGCCCTGCGGG + Intronic
1049997155 9:1044622-1044644 GGGGCTGCAAGAAGGCTCTCGGG + Intergenic
1051029031 9:12651805-12651827 GCTGCTATAAGAGGGCTTGCAGG + Intergenic
1051574747 9:18602409-18602431 GGGGCTATAAGAAATGTTTCTGG + Intronic
1051586107 9:18728637-18728659 GAGGCTGAGAGAAGGCTTCCTGG + Intronic
1053694859 9:40627839-40627861 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1053941844 9:43258219-43258241 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1054269982 9:63012280-63012302 GAGGCTGGCAGAAGGCTTCCTGG + Intergenic
1054306103 9:63427063-63427085 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1054404845 9:64751042-64751064 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1054438469 9:65236534-65236556 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1054491935 9:65785414-65785436 GAGGCTGGCAGAAGGCTTCCTGG + Intergenic
1056115553 9:83438032-83438054 GGTGCTATAAGCAGACTCCCAGG + Intronic
1057567782 9:96180448-96180470 AGGGTTATAAAAAGGCTTCCCGG + Intergenic
1058910898 9:109518978-109519000 GGGGCTCCAGGAAGTCTTCCTGG - Intergenic
1060152578 9:121298348-121298370 GAGATTATAAGAAGGCTTCGTGG - Intronic
1060809625 9:126604005-126604027 GGAGGTAAAGGAAGGCTTCCAGG + Intergenic
1060816151 9:126636302-126636324 GGGGCTGGAAGAGGGCTTCCTGG + Intronic
1061670053 9:132183522-132183544 GGGGCAGTCAGAAGGCTTCCTGG - Intronic
1202777304 9_KI270717v1_random:1445-1467 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1186336427 X:8594258-8594280 GGGGCAATAAGAAGGCATCTTGG + Intronic
1187358027 X:18597083-18597105 GGGGGCATAAGAAGGCTTCCAGG - Intronic
1189397388 X:40635075-40635097 GGGGATATAAGATGACTGCCAGG + Intronic
1189865154 X:45320225-45320247 GGGACAATCAGAAGGTTTCCTGG + Intergenic
1190689434 X:52901178-52901200 GGAGCTTGGAGAAGGCTTCCTGG + Intronic
1190696549 X:52954614-52954636 GGAGCTTGGAGAAGGCTTCCTGG - Intronic
1191665661 X:63700065-63700087 GCAGCTATAAGAAGGCTGCCTGG + Intronic
1196457523 X:115900829-115900851 GGGGTCAAAAGAAGGCTCCCAGG + Intergenic
1196981588 X:121220162-121220184 GGGGCTGAAAGAAGGCTTTGAGG - Intergenic
1198261898 X:134972559-134972581 GGGGATATAAGAAGACTTCCTGG + Intergenic
1198433083 X:136587492-136587514 GGGGGTAGAGTAAGGCTTCCTGG + Intergenic
1198661666 X:138975571-138975593 GGGGCTCTAAGAAGGTTCCTTGG + Intronic
1201192657 Y:11459792-11459814 GAGGCTGGCAGAAGGCTTCCTGG - Intergenic
1201426961 Y:13862024-13862046 GGAGCAATAAGAAGGCATCTTGG - Intergenic