ID: 1158380728

View in Genome Browser
Species Human (GRCh38)
Location 18:56927245-56927267
Sequence TCAGCTCAGCAGGAGATGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158380728_1158380735 26 Left 1158380728 18:56927245-56927267 CCCGACATCTCCTGCTGAGCTGA 0: 1
1: 0
2: 1
3: 11
4: 174
Right 1158380735 18:56927294-56927316 TATATGCCTCGAGATGAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 84
1158380728_1158380734 25 Left 1158380728 18:56927245-56927267 CCCGACATCTCCTGCTGAGCTGA 0: 1
1: 0
2: 1
3: 11
4: 174
Right 1158380734 18:56927293-56927315 GTATATGCCTCGAGATGAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158380728 Original CRISPR TCAGCTCAGCAGGAGATGTC GGG (reversed) Intronic
900520216 1:3101773-3101795 CCAGCTCAGCAGGAGTGATCTGG + Intronic
900565614 1:3330539-3330561 TCAGCTCAGCGGGGGCTGCCTGG + Intronic
903459241 1:23509200-23509222 GCAGCTCAGCTGGAGATGTGAGG + Exonic
903490242 1:23722874-23722896 ACAGCTCTGCAGGAGATGGGTGG + Intergenic
904008969 1:27379327-27379349 CCAGGACAGGAGGAGATGTCAGG + Exonic
904869780 1:33609232-33609254 TCAGTTCTGCAGGAGACTTCAGG - Intronic
905619251 1:39428035-39428057 CCTGTTCTGCAGGAGATGTCAGG - Exonic
906963042 1:50430967-50430989 GCATCTCAGCAGGAAATGTGAGG - Intergenic
910237896 1:85054338-85054360 ACAGCTCAGCTGAAAATGTCAGG + Intronic
911600681 1:99844921-99844943 TCACCTCAGCTGCAGATGGCAGG - Intergenic
912121173 1:106473720-106473742 CCAGCTCTGCTGGAGGTGTCAGG - Intergenic
912947172 1:114095089-114095111 TCAGCTGAGCAGAAAATGGCAGG + Intronic
915265960 1:154718032-154718054 TCTGCCCACCAGGAGAGGTCAGG - Intronic
915294767 1:154912234-154912256 TCACCTAAGCAGGACATGCCAGG + Intergenic
917784176 1:178434668-178434690 CCAGCTCAGCTGGTGCTGTCAGG + Intronic
919727500 1:200893786-200893808 TCCGCTCCACAGGAGATGCCTGG + Intronic
922502809 1:226109746-226109768 GCAGCTCAGGAGGAGGTGACAGG - Intergenic
922861237 1:228818455-228818477 TCTGCTCTGCAGGAGAAGTGTGG - Intergenic
922871282 1:228903983-228904005 TCAGAGCAGCAGGAGCTGTGGGG + Intergenic
923445395 1:234066239-234066261 TCAGCACAGCAGCTGAAGTCAGG + Intronic
924606307 1:245538509-245538531 TCTCCTCAGCAGGGGATGTGTGG + Intronic
1063032321 10:2247848-2247870 TCAGCTCAGCAAGAATTCTCTGG + Intergenic
1065617561 10:27544301-27544323 TCAGCTCAGTAGGAAAAGGCAGG - Intergenic
1066312046 10:34206580-34206602 TCTGCTCTGCAGGAGCAGTCAGG - Intronic
1066500402 10:35988006-35988028 TCAGCACAGCAGGAGAAGAGGGG - Intergenic
1069094264 10:64239425-64239447 TCAGCTCAGCAAAATATGTTGGG + Intergenic
1069343403 10:67439370-67439392 TCAGCTCATAAGGAGGTCTCAGG + Intronic
1069904678 10:71725310-71725332 CCAGCACAGCAGGAGACTTCTGG + Intronic
1070375804 10:75830268-75830290 AAAGATCAGCAGGAGATGTAGGG - Intronic
1071469454 10:85972090-85972112 TGAGATCCACAGGAGATGTCTGG - Intronic
1072463773 10:95644566-95644588 GCAGCTAAGCAGGAGGTGTTGGG - Intronic
1075889575 10:125935088-125935110 TCAGAGTAGGAGGAGATGTCTGG - Intronic
1077640119 11:3873766-3873788 TCAGCTCAGGAGGAGCAGTTAGG - Intronic
1078531839 11:12142626-12142648 TGAGCTCAGCAGGAAGTGTTGGG - Intronic
1081297099 11:41404691-41404713 ACAGCTCTCCAGGTGATGTCTGG - Intronic
1081929180 11:46856690-46856712 TCAGCTCATCTGGAGAAGACAGG - Intergenic
1085476668 11:76793596-76793618 TCAGCTTAGCAGGGGAGGTGGGG + Intronic
1085723390 11:78932885-78932907 GCCGCACAGCAGGAGATGACAGG - Intronic
1088482069 11:110303726-110303748 TCATCTCAGCAGGAGGTGAGAGG + Intergenic
1090610121 11:128463536-128463558 TCAGCTGGACAGGAGATGGCTGG - Exonic
1095990227 12:48029533-48029555 TCAGGCCAGGAGGAGATGGCTGG - Intergenic
1097451120 12:59738119-59738141 TCAACTCCACAGCAGATGTCTGG + Intronic
1103781607 12:123402482-123402504 TGAGCTCAGCAGTTGGTGTCAGG + Intronic
1103918102 12:124386255-124386277 TCCGCCCAGCAGGAGAGGTGGGG - Intronic
1104885268 12:132103805-132103827 TCTGCTCAGCAAGAGATGCTCGG - Intronic
1107069928 13:36258233-36258255 TCAGCTCAGCAGCTGCTGTCTGG + Intronic
1107985594 13:45773575-45773597 TCTGCACAGCAGAAGATGGCAGG + Intergenic
1108431716 13:50360207-50360229 TAATCTAAGCAGAAGATGTCAGG - Intronic
1109453971 13:62558749-62558771 CCAGCTTAGCATGAGATGTCAGG + Intergenic
1110002080 13:70215010-70215032 TCAGCTCATTAGGAGATGTAAGG + Intergenic
1111034140 13:82648409-82648431 CCATTTCAGCAGAAGATGTCAGG + Intergenic
1112626555 13:101111196-101111218 TCCGCTCAGCATGCGCTGTCGGG + Exonic
1113675189 13:112202201-112202223 TGAGCTCAGCTGCAGATGCCAGG + Intergenic
1118759580 14:68871835-68871857 TGGGCCCAGCAGGAGATGTAAGG - Intergenic
1118839392 14:69499808-69499830 TCAGCACAGCAGGAGAGCTGTGG - Intronic
1120985498 14:90331244-90331266 GCAGCTCTGCTGGAAATGTCTGG + Intronic
1123215127 14:106802537-106802559 TCTCCTCAGCTGGAGAAGTCAGG - Intergenic
1123479039 15:20614174-20614196 TCAGAACAGCAGGATGTGTCCGG + Intergenic
1123638973 15:22386211-22386233 TCAGAACAGCAGGATGTGTCCGG - Intergenic
1127264711 15:57352181-57352203 TCAGCACAGCAGGAGAATCCCGG + Intergenic
1128193844 15:65732559-65732581 TAAGAAAAGCAGGAGATGTCTGG + Intronic
1131434249 15:92410711-92410733 TCAGCTCACCATGGGAGGTCAGG - Intronic
1138675017 16:58644958-58644980 TCAGAGCAGCAGTAGATGTGAGG + Intergenic
1139156214 16:64445847-64445869 TCAGTACAGTAGGAGATGTAAGG - Intergenic
1140399718 16:74661269-74661291 TCACCTCAGCAGGAGCTGGCTGG + Exonic
1140996187 16:80261758-80261780 TCAGCTCAGCAAGGGGAGTCTGG + Intergenic
1142363183 16:89636789-89636811 TCAGCCCAGCAGGCGAGGCCCGG - Intronic
1146567382 17:33925011-33925033 TCAGCTGAGCAGAAGAACTCAGG + Intronic
1147243352 17:39105160-39105182 ACGGCTCAGCAGAAGAGGTCAGG + Intronic
1147573821 17:41587413-41587435 TCAGCACAGCATGGGAGGTCAGG - Intergenic
1150298930 17:64032344-64032366 CCAGCTCAGCAGGAGGTGGATGG - Intergenic
1151372801 17:73659550-73659572 TGGCCTCAGCTGGAGATGTCTGG + Intergenic
1152271945 17:79329903-79329925 ACAGATCAGCACGAGAGGTCAGG - Intronic
1152684949 17:81689340-81689362 TCAGCGCAGCAGGAGGCCTCTGG + Intronic
1203158123 17_GL000205v2_random:23902-23924 ACAGCACAGCAGGAGTTTTCTGG + Intergenic
1153981372 18:10313487-10313509 TCAGCTCTGCAGCAGCTCTCTGG + Intergenic
1155324814 18:24655139-24655161 CCAGCTCCTCAGGTGATGTCTGG + Intergenic
1156161457 18:34363362-34363384 ACAGCTGAGCAGTAGATGTGGGG + Intergenic
1158380728 18:56927245-56927267 TCAGCTCAGCAGGAGATGTCGGG - Intronic
1158935139 18:62357748-62357770 TAAGCTCATCAGAAGAGGTCAGG + Intronic
1160058020 18:75504433-75504455 TCAGCTCATGAGGAGCTGTTGGG + Intergenic
1160155382 18:76429621-76429643 TCAGCCCAGCAGGGCGTGTCTGG - Intronic
1162803607 19:13124652-13124674 GCAGCTCAGCAGGATGTGGCTGG - Intronic
1168064674 19:53912370-53912392 TCAGGTCAGCAGGTGAGGTTAGG + Intronic
927605414 2:24482509-24482531 TCAGCTTGGCAGGAGATGAGGGG - Intergenic
928374307 2:30762630-30762652 TCAGGTAAGCAGGTGATGCCAGG - Intronic
929231696 2:39566954-39566976 TCAGTTGAGCAAGAAATGTCTGG - Intergenic
930021214 2:47003319-47003341 TCATCTCACCAGGAGAGGTCAGG - Intronic
932139814 2:69265336-69265358 CCTGCTCAGCAGGAGCAGTCAGG - Intergenic
933973376 2:87488413-87488435 TTAGCTCAGCAGGAAAGGGCTGG + Intergenic
935573739 2:104688238-104688260 GCAGGTAAGGAGGAGATGTCAGG + Intergenic
936320345 2:111461797-111461819 TTAGCTCAGCAGGAAAGGGCTGG - Intergenic
936403416 2:112182959-112182981 TCAGCACAGCAGCAGGTGGCTGG - Intronic
936957184 2:118034278-118034300 GCAGCTCAGCAGCAGCTGACTGG + Intergenic
947243312 2:228019439-228019461 TCAGGCCAGGAGGAGATGCCTGG + Exonic
947889207 2:233602228-233602250 TGAGCTCAGCAGTGCATGTCAGG - Intergenic
948960069 2:241327966-241327988 TCACCTCAGCCTGAGACGTCAGG + Intronic
1170918192 20:20649125-20649147 CATGTTCAGCAGGAGATGTCTGG - Intronic
1171099823 20:22372602-22372624 TCAGCTCAGCACACCATGTCTGG + Intergenic
1172817737 20:37701775-37701797 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817738 20:37701815-37701837 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817739 20:37701855-37701877 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817740 20:37701895-37701917 TCATCTCAGCTGCAGATGTGTGG + Intronic
1172817741 20:37701935-37701957 TCATCTCAGCTGCAGATGTGTGG + Intronic
1175622959 20:60466250-60466272 TCAGTTCAGCATGTGATGTGGGG - Intergenic
1175660166 20:60805441-60805463 TCAGCTCAGCACAGGATGTCAGG - Intergenic
1178418518 21:32424340-32424362 CCTGCTCAACAGGAGATGACAGG + Intronic
1179014880 21:37587884-37587906 TCACCTCAGCTGTAGATGACCGG + Intergenic
1179226199 21:39455544-39455566 TCAGCTCAGCAGGCGCTGTGAGG + Intronic
1179390580 21:40986481-40986503 ACAGCACAGCAGGAGAAGCCTGG + Intergenic
1181310905 22:21944240-21944262 AGAGCTCAGGAGGAAATGTCCGG - Intronic
1182448414 22:30403448-30403470 CCAGCTCAGGAGCAGCTGTCTGG - Intronic
1183407623 22:37638276-37638298 TCAGGCCAGGATGAGATGTCAGG - Intronic
1184297418 22:43533697-43533719 TCAGGTCAGCATGAGACGCCAGG - Intronic
949584598 3:5425420-5425442 TCCCCTCAGCTGGAGATTTCTGG - Intergenic
949766950 3:7537092-7537114 TCAGAGCTGCAGGTGATGTCTGG + Intronic
950422043 3:12904989-12905011 TCAGGTCAGCAAGAGATGCAGGG + Intronic
954452657 3:50580073-50580095 TGGGCTCAGCAGGACAGGTCTGG - Intronic
955387808 3:58492781-58492803 TCAGCCCAGCAGGTGCTGCCAGG - Intronic
955413465 3:58671017-58671039 TGAGCTCACCTGCAGATGTCTGG + Intergenic
956168401 3:66413612-66413634 TCAGTTCACCAAAAGATGTCAGG + Intronic
957025447 3:75176769-75176791 TCTTCTCAGCTGCAGATGTCTGG - Intergenic
961800597 3:129445823-129445845 AGAGCTCAGCAGGTGCTGTCTGG + Intronic
962415607 3:135178783-135178805 TCAGGTCAGCAGGGGAAGGCAGG - Intronic
962627462 3:137240093-137240115 TCATCTCAGGAGAAGATATCGGG - Intergenic
964131693 3:153295987-153296009 TCAGCTGACCAAGAGTTGTCTGG - Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
966867947 3:184271095-184271117 CCAGCTCAGCAGGAGCTGGATGG - Intronic
969055554 4:4399952-4399974 TCTGCACAGCAGGAGATGAGTGG - Intronic
970522014 4:16894672-16894694 TCAGCTCAATAGGAGATACCAGG + Intronic
973148204 4:46856406-46856428 TCAGCTCAGCACTAGAGGACTGG + Intronic
973738000 4:53891378-53891400 TCAGCTCAGCAGGGGAAAGCCGG + Intronic
975474996 4:74813122-74813144 TCAGATCAGCAGGAGATGTTTGG - Intergenic
977666319 4:99650295-99650317 TCACCTCATCAGGAGGTGCCCGG + Exonic
980994061 4:139763710-139763732 GCAGCTCAACAGGAAATATCTGG + Intronic
981158150 4:141464397-141464419 TAAGCTCAGCAGTACATGTGTGG - Intergenic
981542200 4:145857699-145857721 GCAGCCCAGCAGATGATGTCGGG + Intronic
981818794 4:148862408-148862430 TCAGCTAAGCAAGAGAGGCCTGG + Intergenic
985792159 5:1935117-1935139 TCTGCTCAGCAGGATGTTTCTGG + Intergenic
989743419 5:44798842-44798864 TCTGCACAGCAGGAGGTGACTGG + Intergenic
992178463 5:74173723-74173745 AAGGCTCAGCTGGAGATGTCTGG - Intergenic
993009860 5:82468388-82468410 TCAGCTAAGAAGGTGATGGCAGG - Intergenic
994078407 5:95679490-95679512 TCAGCTAAGCATGAGAGGTAAGG - Intronic
996117793 5:119636838-119636860 TCAGCACAGCAATGGATGTCTGG - Intronic
999326761 5:150648885-150648907 TCAGCAGATCAAGAGATGTCTGG + Exonic
1001647329 5:173291895-173291917 TCAGCACAGCAGGAAGTGGCGGG - Intergenic
1001787949 5:174430132-174430154 TTAACCCAGCAGGAGAGGTCGGG + Intergenic
1002675701 5:180910788-180910810 TGAGCTCAGGAGGAGGTGTAGGG - Intronic
1005988639 6:30890019-30890041 TCATCTAAGCTGGAGATGGCGGG - Intronic
1006243813 6:32711620-32711642 GCAGCTCAGAAGGATATGTTTGG + Intergenic
1006377174 6:33678056-33678078 ACAGGTCAGCATAAGATGTCAGG - Intronic
1008895834 6:56553948-56553970 CCAGCACAGCAGGCGATGTGTGG - Intronic
1009710702 6:67314615-67314637 TCAGGTCTGAAAGAGATGTCTGG - Intergenic
1017212457 6:151871744-151871766 AGAGGTCAGCAGGAGATGTGGGG - Intronic
1017382323 6:153844940-153844962 TCAGATCAGCAGGAGGAGGCAGG - Intergenic
1019282160 7:205993-206015 CCAGCCCTGCAGGAGATGGCGGG - Intronic
1019635377 7:2072794-2072816 TCAGCTCAGCACAGGATGGCTGG + Intronic
1023891769 7:44397935-44397957 TGAGTTAATCAGGAGATGTCAGG - Intronic
1024904047 7:54355970-54355992 TGAGCTAAGCTGGAGGTGTCTGG - Intergenic
1030162662 7:106524964-106524986 TCAGAACACCAGGAGATTTCAGG - Intergenic
1032072634 7:128818211-128818233 TCAGCTCATCAGAAGTGGTCAGG - Intronic
1033941047 7:146654191-146654213 TCCTCACAGCATGAGATGTCTGG + Intronic
1037526525 8:19729955-19729977 TCAGCTCACCAGCAGAAGTAGGG + Intronic
1038833520 8:31091594-31091616 TCAGGGCAGCAGGGGATGACAGG - Intronic
1042617667 8:70668535-70668557 TCAACTCAGCAGCAGAGGGCAGG - Intronic
1042845816 8:73168555-73168577 TCAGCTCAGATGGCGAAGTCAGG + Intergenic
1043832859 8:85010925-85010947 TCAGCTCAGCATGAGCTCCCGGG - Intergenic
1044174767 8:89106141-89106163 TCAGATCAGCAGGAACTGTCAGG - Intergenic
1047274401 8:123395043-123395065 TCAGTTCAGCAGACGATTTCAGG - Intronic
1048944375 8:139430818-139430840 TCAGCTGAGAAGGTGAAGTCTGG + Intergenic
1049163526 8:141112438-141112460 TCAGCTCAGCGGGAGAGCTGGGG + Intergenic
1049695555 8:143982808-143982830 TCAGCTGACCAGGAGCTGACAGG - Intronic
1050612169 9:7364227-7364249 TCAGCTCAGCCAGTGATATCTGG + Intergenic
1055394437 9:75858903-75858925 TCATCTCCCCAAGAGATGTCAGG + Intergenic
1056270244 9:84940359-84940381 TCATCTCGGCAGGAGACATCAGG + Intronic
1058878035 9:109261022-109261044 ACAGCCCAGCAGTAGATGTCAGG - Intronic
1061620112 9:131806485-131806507 TGGGCTCAGCAGGAGATGTGTGG - Intergenic
1062342736 9:136100944-136100966 CCAGCTCTGCGGGAGATGTAGGG - Intergenic
1187456346 X:19444637-19444659 TCTGCTCTGCAGAAGATGCCAGG - Intronic
1187939511 X:24368155-24368177 CCAGCACAACAGGACATGTCAGG + Intergenic
1195050280 X:101090564-101090586 GCAGCTCAGTAAGAGAAGTCTGG - Intronic
1195922374 X:109996373-109996395 GCAGCACAGCAGGAGATGAGTGG - Intergenic
1196083679 X:111660585-111660607 GCAGCTCAGCAGGAGATTGGAGG + Intergenic
1199200053 X:145076555-145076577 GCTGCTCAGCAGGAGATGAGCGG - Intergenic
1199739388 X:150718935-150718957 TCAGTTCACCAGGAAAAGTCAGG - Intronic
1200048978 X:153418420-153418442 TCAGCCCAGCTGGAGAGGCCTGG - Intronic
1201471214 Y:14336779-14336801 TCAGCTCAGAAAGAGAGGTAGGG + Intergenic