ID: 1158381947

View in Genome Browser
Species Human (GRCh38)
Location 18:56941467-56941489
Sequence CTTGAATTGCAGAGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158381947 Original CRISPR CTTGAATTGCAGAGGGAACC AGG Intronic
902622550 1:17658962-17658984 CTTGATTTGGTGGGGGAACCCGG + Intronic
905791324 1:40791303-40791325 CTTGAAATGCATAGGGTACCAGG + Intronic
906256813 1:44356638-44356660 TTTAAATTGGAGAGGGAAGCTGG + Intergenic
906775956 1:48529816-48529838 CTTGACATGCAGAGGGCCCCTGG - Intergenic
908092299 1:60698982-60699004 CTTGATTTGCAAAAGGAACCAGG + Intergenic
909155000 1:72062816-72062838 CTTGTCTTGCAAAGGAAACCAGG + Intronic
910065760 1:83148697-83148719 CTGGAATTGCAGAGAGATCAAGG + Intergenic
910112436 1:83696983-83697005 CTGGAAGTGGAGAGGTAACCTGG - Intergenic
910290584 1:85596660-85596682 CTGGAATTGTAGAAGGAAGCGGG - Intergenic
913547102 1:119879962-119879984 CTTGAATTGAGGAGAGAACATGG - Intergenic
916170533 1:161998463-161998485 CTTGAGTTACAGAGGGGGCCTGG + Intronic
916533864 1:165684621-165684643 CTTGAATTCAAGAGGAAACTAGG + Intronic
919071514 1:192761806-192761828 CATGCATTGCAGTGGGCACCAGG - Intergenic
922542874 1:226432613-226432635 CTGGAATTGCACAGGGATCATGG + Intergenic
1063028069 10:2202549-2202571 CCTGAATTCCAGAGGGAGCAGGG + Intergenic
1065859988 10:29864479-29864501 GTTGGATTGCCGAGAGAACCAGG - Intergenic
1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG + Intergenic
1070916582 10:80158914-80158936 GTTCAACTGCACAGGGAACCGGG + Intronic
1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG + Intronic
1071353558 10:84770280-84770302 CTAGAACTGCAGAGGTAAGCAGG + Intergenic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1081411277 11:42761125-42761147 ATTGGATTCCAGAGAGAACCAGG - Intergenic
1082783559 11:57304205-57304227 CTTTAATCCCAGTGGGAACCTGG - Intronic
1083455878 11:62778298-62778320 CCTGGATGGCAAAGGGAACCTGG + Exonic
1083759411 11:64807488-64807510 CTTGACTTGCTGTGGGACCCTGG - Intronic
1091487050 12:899631-899653 CTTGAATTCAACTGGGAACCGGG + Intronic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1093591093 12:20903706-20903728 GTTGAATTGGAGAAGGAACCTGG - Intronic
1097244794 12:57601614-57601636 CTTGAACATCAGAGAGAACCAGG - Exonic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1102823599 12:115927804-115927826 CTTGGATGGCAGAATGAACCTGG - Intergenic
1103855480 12:123966509-123966531 GCTGAACTGCAGAGTGAACCTGG - Intronic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1106565325 13:30879778-30879800 CTTGACTTGAAGAGCCAACCAGG + Intergenic
1110070097 13:71164373-71164395 CTCGAATTAAAGAGGAAACCAGG + Intergenic
1112029527 13:95444315-95444337 CTTGAATTGCAGAAGGCAGCAGG + Intronic
1118132692 14:62985048-62985070 CTTGATTTGCAGAAAGAAACAGG + Intronic
1119157296 14:72422842-72422864 CTTGACTTGCAGATGGGCCCTGG - Intronic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1133929698 16:10222304-10222326 CTAGAATTGCAGATGGAAGAAGG + Intergenic
1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG + Intronic
1139353845 16:66355224-66355246 ATAGAATTGCAGAGGGAAGAGGG + Intergenic
1140154287 16:72406628-72406650 CTTAAAGTGCTGAGGGAAGCAGG + Intergenic
1142576544 17:912549-912571 CTTTAATTGCAAACAGAACCAGG + Intronic
1142669098 17:1479331-1479353 CCAGCATTGCTGAGGGAACCAGG + Intronic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1142732166 17:1867096-1867118 TTTAAATTGGAGAGGGAATCGGG + Intronic
1145904010 17:28506551-28506573 CTTGAGCTGCAGTGAGAACCTGG - Intronic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1149358194 17:55866075-55866097 CTTCAAATGCAGATGGCACCAGG + Intergenic
1149610107 17:57953769-57953791 CTTGAATAGAAGAGAGACCCTGG - Intronic
1150280581 17:63927785-63927807 CTGGAATTCCAGAGGGAATCTGG + Intergenic
1150678337 17:67264037-67264059 CTTGATTTTCAGATGGAACATGG + Intergenic
1153154560 18:2133845-2133867 CTTGAAATGGAAAGGGATCCAGG - Intergenic
1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159253426 18:65912040-65912062 CTTAAATTGCAGAGAAAACTTGG + Intergenic
1159750237 18:72291968-72291990 TGTGAAATGCAGAAGGAACCTGG - Intergenic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163129996 19:15266378-15266400 CTTGAGATGCACAGGGAACATGG - Intronic
1165199756 19:34134343-34134365 CTAAATTTGCAGAGGGACCCAGG + Intergenic
927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG + Intergenic
929893933 2:45941696-45941718 CTTGAATTGCTCAGTGACCCAGG - Intronic
929982916 2:46698541-46698563 CTTGAATTGCAGGAGGTGCCCGG + Intergenic
931707443 2:64958821-64958843 GTTGAAATGAAGAGAGAACCAGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933326906 2:80849513-80849535 CATGAATAGCAGAGGGTAGCTGG + Intergenic
935858661 2:107303111-107303133 CTGGAATTGCTGATGAAACCTGG + Intergenic
940044768 2:149398015-149398037 CTAGAATTAAAGAGGGAACACGG + Intronic
941153579 2:161946487-161946509 ATTGAATTGCAGAGAGATCTTGG - Intronic
947119758 2:226801308-226801330 CTTGCACTGCAGAGGGAAGGTGG + Intergenic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
1172446038 20:34993922-34993944 CGGGAATTGCAGAGGCCACCAGG + Intronic
1172707547 20:36893426-36893448 CTTTTATTGCAGAGGGGACCAGG - Exonic
1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG + Intergenic
1177398010 21:20562680-20562702 ATTGTATTGCACAGGGAACCAGG - Intergenic
1178736987 21:35161380-35161402 CTTACATTTCAAAGGGAACCTGG - Intronic
1179476612 21:41650642-41650664 CTGGAAGTGAAGATGGAACCAGG - Intergenic
1182000886 22:26918963-26918985 CTTGCATGGCAGAGGAGACCTGG + Intergenic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
1185291164 22:50028522-50028544 CCTGAATCGCAGTGGGAATCAGG + Intronic
949094800 3:73513-73535 TTTGAATTGCAAATGAAACCTGG - Intergenic
954150107 3:48653057-48653079 CTGGAGTTGCAGGAGGAACCAGG - Exonic
955685612 3:61545622-61545644 CTGGAATTGCAGAGAGAGCTGGG - Intergenic
956221397 3:66907666-66907688 CTGTAATTGCTGAGGGAACCAGG - Intergenic
963851589 3:150215661-150215683 CTTCAATGGAAGAGGGTACCTGG - Intergenic
965157475 3:165082660-165082682 CTGGAAATGCAGAGAGAGCCAGG + Intergenic
966638797 3:182165559-182165581 CCAGAACTGCAGAGAGAACCTGG + Intergenic
968343782 3:197982659-197982681 TATGAATTGCAGAGGGAGACAGG + Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG + Intergenic
973785616 4:54330068-54330090 TCTGAATTCCAGAGGGAACAGGG - Intergenic
975461932 4:74664046-74664068 TTTGAATTGGAGAGAGAAACTGG + Intergenic
978823995 4:112999150-112999172 TCTGTATTGCAGAGGGAAACTGG - Intronic
978892636 4:113848316-113848338 CATGTGTTGCAGAAGGAACCTGG - Intergenic
982207624 4:153008798-153008820 CTTGAGTTGCAGAGGAAATGGGG + Intergenic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
989312115 5:40031924-40031946 CTTGAATTTCAGAAGAGACCTGG - Intergenic
993502936 5:88682302-88682324 TTTGAAATGCAGTGGGAAACAGG - Intergenic
997601514 5:135141750-135141772 CGTGAATTGTTGAGGGCACCTGG + Intronic
1003331253 6:5130390-5130412 CTGGCATTGCACAGGGGACCTGG + Intronic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1008139355 6:47814073-47814095 ATTGAGTTGCAGAGTGAAGCAGG + Intronic
1009811539 6:68673858-68673880 CTTCAAATGCAGAGGGAATAGGG + Intronic
1011626368 6:89286831-89286853 CTTGTGTTCCAGAGGGAAGCTGG + Intronic
1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG + Intergenic
1013968425 6:115984713-115984735 TGTGAATGGCAGAGGGAAACAGG - Intronic
1015571590 6:134626663-134626685 CTTGAATGCCAGAGAGAGCCAGG - Intergenic
1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG + Intergenic
1030089360 7:105843681-105843703 ATTGAAAAGAAGAGGGAACCTGG - Intronic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1033424436 7:141231157-141231179 CTGGAAATGCAGAGGCAAACAGG - Intronic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1036401233 8:8410288-8410310 CTAGAATTGCACAGAGAACAGGG + Intergenic
1036786451 8:11691182-11691204 CTTGGATTGCAGATGAAAACTGG - Intronic
1038169122 8:25112833-25112855 CTTGAAATGAGGAGGGAAACAGG - Intergenic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG + Intronic
1043571323 8:81606137-81606159 TTTGAAGTGAAGAGTGAACCTGG - Intergenic
1044997850 8:97854287-97854309 CTAGAAATGGAGAGGGCACCAGG + Intergenic
1045062897 8:98424255-98424277 CTTGAATGGCAGAGTGAACTTGG - Intronic
1046437323 8:114208390-114208412 GTTGAATTGCTGAAGGAAGCAGG - Intergenic
1047360857 8:124167846-124167868 CTTGAATGACAGAAGAAACCTGG - Intergenic
1049575581 8:143388388-143388410 CTGGAGGTGCAGCGGGAACCAGG - Intergenic
1054744707 9:68843018-68843040 CGTGAAGGGCAGAGGGAAGCTGG - Intronic
1061531603 9:131218497-131218519 TTTGAAAGGCAGAAGGAACCAGG - Intronic
1061936507 9:133860638-133860660 CTGGAATGGCAGAGAGAGCCTGG - Intronic
1062133150 9:134911074-134911096 CTTGGAAAGCAGAGAGAACCTGG - Intronic
1187817635 X:23249944-23249966 TTTGATTTGCAGAGTGAAACTGG + Intergenic
1190411399 X:50140434-50140456 CTTCAAGTCCAGAGGGAACAAGG - Intergenic
1195156990 X:102133451-102133473 CTTGAATTTCAGTTGGTACCAGG + Intergenic
1198175723 X:134152511-134152533 CTTTACTTGCACAGGAAACCAGG + Intergenic
1199975081 X:152890005-152890027 CTTGGATGGCAGAGGGAATGAGG + Intergenic
1201477598 Y:14399972-14399994 CTAGTATTTCAGAGGTAACCAGG + Intergenic