ID: 1158387846

View in Genome Browser
Species Human (GRCh38)
Location 18:57014948-57014970
Sequence CAGTAGAGATGGAGAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 1, 2: 12, 3: 52, 4: 323}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158387846_1158387853 20 Left 1158387846 18:57014948-57014970 CCAGCTGTTCTCCATCTCTACTG 0: 1
1: 1
2: 12
3: 52
4: 323
Right 1158387853 18:57014991-57015013 AAGCTTCAACTGCAGTGTTTTGG 0: 1
1: 0
2: 0
3: 16
4: 136
1158387846_1158387850 -7 Left 1158387846 18:57014948-57014970 CCAGCTGTTCTCCATCTCTACTG 0: 1
1: 1
2: 12
3: 52
4: 323
Right 1158387850 18:57014964-57014986 TCTACTGAGGCCAGGACCAGAGG 0: 1
1: 1
2: 3
3: 53
4: 559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158387846 Original CRISPR CAGTAGAGATGGAGAACAGC TGG (reversed) Intronic
901380089 1:8867296-8867318 CAGTACAGCAGGAGAAAAGCTGG - Intronic
904407566 1:30303070-30303092 CAGTAATTATGGAGAAGAGCTGG + Intergenic
905028367 1:34866031-34866053 CAGTACGGGTGGAGAACCGCGGG + Exonic
905307559 1:37030058-37030080 CAGTTGAGAAGGAGGAAAGCTGG + Intronic
905425686 1:37882328-37882350 AAGCAATGATGGAGAACAGCAGG + Intronic
905836018 1:41121971-41121993 CAGTAGAGATGGTGAAATGTGGG - Intronic
906185807 1:43861072-43861094 CAGCAAAGATGGAATACAGCTGG + Intronic
907150309 1:52279856-52279878 AAGTACACATGGAGAACTGCAGG - Intronic
908895922 1:68898932-68898954 CAGTAGGGAGGGAGAGCATCAGG - Intergenic
909409050 1:75328082-75328104 CAGCAGGGATGGAAAGCAGCTGG - Intronic
910044310 1:82893078-82893100 AAGTAAAGATGGAGAATAGTTGG - Intergenic
910125396 1:83836445-83836467 CAGTGGAGATAAGGAACAGCTGG - Intergenic
910566287 1:88646680-88646702 GAGTTGATATTGAGAACAGCTGG + Intergenic
911352790 1:96774606-96774628 CAGGAAAGATGGAGAAAACCAGG - Intronic
911436569 1:97867121-97867143 CATTAGACATGGATAACAGAGGG + Intronic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
913239535 1:116817935-116817957 CTGCAGAGATGGAGCCCAGCTGG + Intergenic
916164796 1:161956634-161956656 CAGCAGGGAGGAAGAACAGCTGG - Intronic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
918120367 1:181532860-181532882 TACTGGAGATGGAGAACACCTGG + Intronic
919755398 1:201062995-201063017 CAGCAGAGTTGGAGCCCAGCTGG + Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
921031093 1:211335825-211335847 CAGGAGAGGTGGAGGACAGGTGG + Intronic
921559930 1:216644885-216644907 CAGTAGGAAAGGAGAAGAGCAGG - Intronic
921617131 1:217282466-217282488 TAGTATAGATGGAGAATAGATGG - Intergenic
924194315 1:241589436-241589458 CAGGAGAGATGGCAAATAGCTGG - Intronic
924753045 1:246914888-246914910 CAGTAGAAATGGAGAAGATGGGG - Intronic
1063779486 10:9304914-9304936 CAGCAGGGATTGAGTACAGCAGG - Intergenic
1063884265 10:10561835-10561857 CAGTAGAGACAGAGAACAAGGGG + Intergenic
1064142080 10:12799045-12799067 GAGTAGAGATGGAGGCCAGGAGG + Intronic
1066331188 10:34425114-34425136 CAGTAGAGATGGAAAAAAATTGG - Intronic
1068434354 10:56971488-56971510 CAAAGGAGATGGAGAACAGCTGG - Intergenic
1068503028 10:57864331-57864353 CAGTAGAGATGGATTTCAGCAGG + Intergenic
1068823344 10:61403935-61403957 CAGAAGAGATTGAGAACTGAAGG - Intergenic
1069706263 10:70460575-70460597 CAGAAGAGATGGGGAGGAGCAGG - Intergenic
1069917343 10:71795756-71795778 CAGCAGGGATGGAGCAGAGCAGG - Exonic
1070109193 10:73466077-73466099 AAGTGAAGATGGAGAACAGTAGG - Intronic
1070158879 10:73853492-73853514 AAGTCAAGATGGAGAAAAGCCGG + Intronic
1070364112 10:75719377-75719399 TGGTTAAGATGGAGAACAGCTGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071981965 10:91012491-91012513 CAGTATAGTTGGAGAAAAGTTGG + Intergenic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072484989 10:95846491-95846513 CAGTGGAGACAGGGAACAGCTGG - Intronic
1072940344 10:99758190-99758212 AAATAGTGATGGAGAACAGCTGG - Intergenic
1074687885 10:115976569-115976591 CAGGAGAGATGGAGAAAGGCAGG + Intergenic
1075162035 10:120032840-120032862 TAGTTGAGAAGGAAAACAGCAGG + Intergenic
1076632725 10:131861119-131861141 CAGTAGAGTTGGAGTAAAGCAGG + Intergenic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1079981998 11:27160931-27160953 CAGTAGAGATATGGAGCAGCTGG - Intergenic
1080379821 11:31756751-31756773 AAGTAGAGAAGGAGAAAAGCAGG - Intronic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1085360435 11:75880501-75880523 CAGCAGAGATGGAGAACCAGTGG - Intronic
1085381693 11:76125544-76125566 CAGTCAGGATGGAGAACAGCTGG + Intronic
1085659420 11:78350152-78350174 CAGGGGAGATGGACTACAGCTGG - Intronic
1086199710 11:84186953-84186975 CAGTTGAGATGGACAACTGAGGG - Intronic
1086743390 11:90395765-90395787 CTTTAGGGATGGAGAACAGCTGG + Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1088549854 11:111001666-111001688 CAGTAGAGCTGGAGAAGAGAAGG + Intergenic
1090331503 11:125935897-125935919 GAGTCGAGACGGAGAACACCAGG + Intergenic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1091573841 12:1714298-1714320 CAGTAGGGATCGAGAAGAACAGG - Intronic
1091682142 12:2534720-2534742 CACTAAAGAAGGAGAACTGCAGG - Intronic
1091857910 12:3753762-3753784 CAGCAGCCATGAAGAACAGCTGG - Intronic
1091888673 12:4035084-4035106 CAGAAAAACTGGAGAACAGCTGG + Intergenic
1091983513 12:4886564-4886586 CAGCAGAAATGGCAAACAGCAGG + Intergenic
1092087783 12:5777971-5777993 CAGAGGAGATGGGGAACAGCTGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092754210 12:11748099-11748121 CAGATAAGATGGAAAACAGCAGG - Intronic
1093713004 12:22349292-22349314 CAGTAGAGATGAAGAAAAGAGGG + Intronic
1094042047 12:26128484-26128506 CAGCAGAGCTGGTGAACAGCTGG - Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095474493 12:42572086-42572108 AAGTAGAGATGAAGATCATCTGG - Intronic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096079045 12:48821807-48821829 CAGGAGAGATGAGGAACAGTCGG + Intronic
1096113511 12:49042137-49042159 CAGGTGAGATGGTGGACAGCTGG + Exonic
1098017025 12:66115706-66115728 CAGTGGAGATTTGGAACAGCTGG + Intergenic
1099673651 12:85728692-85728714 GAGTAGACTTTGAGAACAGCCGG - Intergenic
1100235531 12:92657106-92657128 GAGTAGAGATGGAAATCATCTGG - Intergenic
1100602891 12:96127382-96127404 CCATGGAGATGGAAAACAGCTGG + Intergenic
1102807144 12:115792049-115792071 CTGCACAGATGGAGCACAGCAGG + Intergenic
1103467461 12:121153211-121153233 CAGCCAAGGTGGAGAACAGCTGG + Intronic
1104159383 12:126163804-126163826 GAGGAGAGAGGGAGAACACCTGG + Intergenic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1106055536 13:26233249-26233271 CAGTTGAGATTGAGAACCACTGG + Intergenic
1106166064 13:27247554-27247576 CAGTACAGAAAGAGAAGAGCAGG + Intergenic
1106191211 13:27454273-27454295 CAGTAGAGCTGGAGAACATCTGG + Intergenic
1106481400 13:30139913-30139935 CAGTTGAGAGGGAGAGCGGCCGG - Intergenic
1108020309 13:46121371-46121393 CAGTCAGGATTGAGAACAGCTGG + Intergenic
1109288665 13:60445317-60445339 CAGGAGAAATGGAGTACATCTGG + Intronic
1110159268 13:72356078-72356100 GAGTAGAGATGAAGAACAAAGGG - Intergenic
1111149952 13:84238579-84238601 AAGAAGAGATGCAGAACAGATGG + Intergenic
1111285343 13:86084036-86084058 CCATAGAGATGGAAAACAGATGG + Intergenic
1111606358 13:90545325-90545347 CACAAGGGATGGAGCACAGCAGG - Intergenic
1112058145 13:95710069-95710091 CAGTATAAATGAAGAGCAGCTGG - Intronic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1112175537 13:97019939-97019961 CAGTAGAGACAGAGAAAAACTGG - Intergenic
1113202713 13:107884836-107884858 TGGTAGAGATGGATAACAGGAGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115774652 14:36702153-36702175 CAGTAGAGAAGGAGAAATGGAGG - Intronic
1116647597 14:47549131-47549153 CAGTAGCTATGGAAACCAGCAGG - Intronic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1118608623 14:67522252-67522274 CAGTAGAGTGGGAGAGGAGCGGG - Intronic
1118718507 14:68577170-68577192 CAGTAATAATGGAGAACAACTGG - Intronic
1118745150 14:68768064-68768086 CCCAGGAGATGGAGAACAGCCGG + Intergenic
1120140455 14:80924922-80924944 CAGTGGAGATGAAGTATAGCAGG + Intronic
1121971296 14:98358845-98358867 CAGTAGAAATGGAGAAAGGGTGG - Intergenic
1123009152 14:105338856-105338878 CAGGAGGGAGGGAGAAGAGCGGG - Intronic
1124940860 15:34216728-34216750 CAGAAGAGTTGGAGAACAATAGG - Intergenic
1126575577 15:50193159-50193181 CGGTGGAGATGAAGATCAGCTGG - Intronic
1126957632 15:53951889-53951911 CAGTGGATCTGGAGACCAGCTGG + Intergenic
1128259442 15:66222302-66222324 CAGTATAGTTGGGGAGCAGCTGG - Intronic
1128784944 15:70388056-70388078 CACTAGAGGTGGAGAACCACTGG + Intergenic
1128833675 15:70791949-70791971 CAGTTGAATTGGAGCACAGCTGG + Intergenic
1128997797 15:72309604-72309626 CAGTGGTGATGGAGGACACCTGG + Intronic
1129254729 15:74327678-74327700 CAGCTGAGTTGGAGAACAGGAGG + Intronic
1129305331 15:74656817-74656839 CAGCAGAGATGAGAAACAGCTGG + Intronic
1129828181 15:78649115-78649137 TAGTAAAGATGTGGAACAGCAGG + Intronic
1130884314 15:88080771-88080793 CATCAGAGGTGGAGAGCAGCAGG + Intronic
1131075381 15:89492211-89492233 AAGGGGAGAGGGAGAACAGCTGG - Intronic
1139240515 16:65387142-65387164 CTGTAGAGATGGAAAACATGTGG - Intergenic
1139590723 16:67931435-67931457 GGGTAGAGATGGGGAACAGCGGG - Intronic
1139846817 16:69927315-69927337 CAGCAGAGAGGGACACCAGCAGG - Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1142008010 16:87699385-87699407 CAGTGGTGATGTAGAAAAGCAGG + Intronic
1143802478 17:9395647-9395669 CAGTTGACATAAAGAACAGCAGG - Intronic
1144036011 17:11366653-11366675 CAGGACAGATGGAGAAGAGTGGG + Intronic
1144282334 17:13738545-13738567 CAGTAAGGAAGGAGAACAGGAGG + Intergenic
1144554285 17:16268051-16268073 CAGCAGAGATGGAGCACAAGGGG + Intronic
1144954700 17:19013196-19013218 GAGTTATGATGGAGAACAGCAGG + Intronic
1146477055 17:33171524-33171546 CAATGGTGATGGAGAAAAGCAGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146733577 17:35216904-35216926 TAGTGGAGATGGAGAAGGGCAGG + Intergenic
1149595607 17:57862852-57862874 CAGGAGAGATAGAGAACGGACGG + Exonic
1151204815 17:72498599-72498621 CAGTATGAATGGATAACAGCTGG + Intergenic
1151379779 17:73717693-73717715 CCCTAGAGATGGAGCAGAGCTGG + Intergenic
1151953864 17:77370994-77371016 CAGAGGAGATGGGAAACAGCTGG - Intronic
1152816278 17:82410018-82410040 CAGGAGAGATGGGGAGCAGTGGG - Intronic
1153521398 18:5957785-5957807 CAGTAGAGATGGAGCAGGGGCGG - Intronic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1159743038 18:72197030-72197052 AAGGAGAGATGCAGAAAAGCGGG + Intergenic
1159744195 18:72210995-72211017 CAGTGAAGATGCAGAACAGTTGG + Intergenic
1159973752 18:74685350-74685372 CAGGATAGATGGTGAGCAGCTGG - Intronic
1160220609 18:76974749-76974771 GGGTAGAGATGGACAACAACTGG + Intergenic
1160970349 19:1765160-1765182 TAGAGGAGATGGAGACCAGCTGG - Intronic
1161597382 19:5157527-5157549 CAGCAGACATGGAGAAGAGGAGG - Intergenic
1163709892 19:18840188-18840210 CAGTGGAGACGGAGGACACCGGG + Intronic
1164771212 19:30810646-30810668 AGGTAGAGATGGTGACCAGCAGG - Intergenic
1165491883 19:36128276-36128298 AAGTAGAGATGCAGGAAAGCAGG - Intergenic
1165934299 19:39380051-39380073 CACTAGAGATGCAGAACTACCGG + Exonic
1165989652 19:39802770-39802792 CAGGAGAGAGGGAGAATGGCAGG - Intergenic
1167412253 19:49351586-49351608 CAGTTGAGATGCAGCAGAGCTGG + Intronic
1168138924 19:54371769-54371791 CAGTGGAAATGGAGAAACGCAGG - Intergenic
1168159010 19:54496094-54496116 CAGTGGAAATGGAGAAACGCAGG + Intergenic
1168592954 19:57652057-57652079 GAGGAGGGATGGAGAAGAGCTGG - Intergenic
925239680 2:2312877-2312899 AAGCAGAGAGGAAGAACAGCAGG + Intronic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
928157293 2:28888269-28888291 CAGGAGAGATGGGGCACAGGTGG + Intergenic
929098567 2:38286972-38286994 GAGTAGACATGGAGGACAGGAGG + Intergenic
929459739 2:42094270-42094292 CAGTAAGGAAGGAGAACAGGTGG + Intergenic
929581274 2:43082985-43083007 CAGAAGCCATGGGGAACAGCAGG + Intergenic
929922476 2:46182408-46182430 CACTGGAGAGGGAGAACAGATGG + Intronic
930164838 2:48194808-48194830 CAGTGGGGATGGGGAAGAGCAGG - Intergenic
930251441 2:49038892-49038914 CAATAGAGAAGGAGAAAAGAAGG + Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931090384 2:58879555-58879577 CACTAGAAATGAAGAATAGCAGG + Intergenic
931159472 2:59673117-59673139 CAATAAAGACGGAAAACAGCTGG - Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
932668794 2:73719201-73719223 CTATAGAGATGGAGAACCCCAGG + Intergenic
932809768 2:74815044-74815066 CTGTAGAGAGGGAGAAAAGCGGG - Intergenic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
932948800 2:76269139-76269161 GAGAGGAGATGGAGACCAGCTGG - Intergenic
934159054 2:89230830-89230852 CACTAGAGAATCAGAACAGCAGG + Intergenic
934208220 2:89951595-89951617 CACTAGAGAATCAGAACAGCAGG - Intergenic
934753068 2:96806462-96806484 GAGTAGAGATGAAGAACAAAGGG - Intronic
934902029 2:98167116-98167138 CAGGAGAGATGGTGGCCAGCGGG + Intronic
935014339 2:99165823-99165845 CACTAGTGATGCAGAACATCTGG + Intronic
936001303 2:108832875-108832897 CAGTATAGTTCTAGAACAGCAGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937033576 2:118762178-118762200 TCGTGGAGATGGAGCACAGCTGG + Intergenic
939193588 2:138945257-138945279 CAGGAGTGATGGAGAATACCTGG - Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
940876967 2:158907499-158907521 GGGTAAAGATGGAGAAAAGCAGG + Intergenic
942323145 2:174753533-174753555 CAGTTAAGAAGGAGAAGAGCAGG + Exonic
942758429 2:179369355-179369377 CAGTAGGGATGGAGGACCGAGGG - Intergenic
944610356 2:201398247-201398269 CCGAAGAGGTGTAGAACAGCTGG + Exonic
946123264 2:217535488-217535510 CAGAAAAGACAGAGAACAGCTGG - Intronic
946704910 2:222448926-222448948 CACTGGAGATGGGGAACAGCTGG - Intronic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
947516594 2:230810729-230810751 CAGTAGAGCAGGAGCAGAGCCGG - Intronic
948485900 2:238280682-238280704 GAAGAGAGATGGAGGACAGCCGG + Intronic
1170048607 20:12114387-12114409 CAGTTGAGATTGAGAACCACTGG + Intergenic
1170457590 20:16547870-16547892 CAGCAGAGCTGGAGAACTCCAGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1172137591 20:32697661-32697683 CAGTGGAGATGGAGCACTGGAGG + Intergenic
1172977221 20:38915300-38915322 CAGTTGAGATTGTGAACAACTGG + Intronic
1173029850 20:39345394-39345416 CAGTAAAGATAGAGAAGATCTGG + Intergenic
1173336658 20:42117495-42117517 GAGTTGAGATGGAGCAGAGCAGG + Intronic
1173504492 20:43576199-43576221 GGGGAGAGAGGGAGAACAGCTGG - Intronic
1175148630 20:56915545-56915567 CAGTAGAGAGGTATAAGAGCAGG + Intergenic
1177036682 21:16052946-16052968 CACTGAAGAAGGAGAACAGCTGG - Intergenic
1177089093 21:16743660-16743682 CAGTAGGCATGGAGATCACCTGG - Intergenic
1182367586 22:29789322-29789344 AAGGAGAGATGGAGCCCAGCAGG + Intronic
1182554814 22:31123367-31123389 CAGCAAAGGTGGAGCACAGCTGG - Intronic
1182888749 22:33798545-33798567 TGGTAAAGATGGAGAAAAGCAGG - Intronic
1183495298 22:38139929-38139951 CAGGAGAGCTGGAGCCCAGCAGG + Intronic
1184068638 22:42135112-42135134 CTGTGGTGATGGATAACAGCTGG - Intergenic
1184547802 22:45183949-45183971 CAGTAGTGGTAGAGAACAGGGGG + Intronic
1185395699 22:50586527-50586549 CAGAGGAGTTGGTGAACAGCAGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951071609 3:18335478-18335500 CAGAAACCATGGAGAACAGCAGG - Intronic
951154770 3:19337678-19337700 CAGTAGACATGGAGCAAAGCTGG - Intronic
951496483 3:23333439-23333461 CAGTAGGGAGGGAGAACCTCAGG + Intronic
952682474 3:36110584-36110606 CAGGTTATATGGAGAACAGCTGG + Intergenic
953134840 3:40173466-40173488 CATTAGAGATGTAGGACAGTGGG + Intronic
954854573 3:53632754-53632776 AGAGAGAGATGGAGAACAGCTGG + Intronic
954984741 3:54779696-54779718 CAGTAGAGAAGCAGAGCAGCAGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956520057 3:70094196-70094218 CGATAGGGATGGAGAGCAGCAGG - Intergenic
957341652 3:78906170-78906192 TATGAGAGATGGAGGACAGCTGG - Intronic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
963121884 3:141783428-141783450 TAGTAAGGATGAAGAACAGCTGG + Intronic
963371583 3:144407815-144407837 CAGTAGAGATGAAGAACAGCTGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
965433512 3:168618808-168618830 CAATAGAACTGGAGAAAAGCTGG - Intergenic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
965946754 3:174251876-174251898 CAGAAAAGATGGAAAACATCTGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967049961 3:185774041-185774063 AAGGAGAGGTAGAGAACAGCAGG - Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969258290 4:6017847-6017869 AAGAAGAGAGGGAGAACACCTGG + Intergenic
969401258 4:6957102-6957124 CAGTACAAATGAAGAACAGCTGG - Intronic
969885811 4:10214395-10214417 CATACGAGATGGTGAACAGCTGG + Intergenic
969965523 4:10990551-10990573 CAGCAGAGGTGGAGCAAAGCTGG + Intergenic
970608166 4:17701727-17701749 CAGTACAGCTCTAGAACAGCTGG - Intronic
970748546 4:19329877-19329899 CATCAGAGAGGGAGAACAGCTGG - Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
973816499 4:54624360-54624382 CAGTGGAGCTGGGGAACAGCTGG + Intergenic
973945907 4:55955537-55955559 CAGAAGAGATAGAGAAAAGTGGG + Intronic
974115805 4:57577960-57577982 CAGTAGAAATAAAGAATAGCTGG - Intergenic
974930871 4:68359522-68359544 CAGGAGAGAAGGAGAACATTTGG - Intergenic
975083278 4:70306204-70306226 CGGTAAAGATCAAGAACAGCTGG + Intergenic
975621342 4:76299884-76299906 GTGCAGGGATGGAGAACAGCAGG + Intronic
975910513 4:79260587-79260609 CAGCAGAGATGGAAATCAGCTGG - Intronic
977224444 4:94378174-94378196 AAGGAGAGGTGGAGAACAGCTGG - Intergenic
978141957 4:105328163-105328185 CAGTGGAAATAGAAAACAGCTGG - Intergenic
978195810 4:105970536-105970558 TAGTGCATATGGAGAACAGCTGG - Intronic
978485062 4:109243634-109243656 CATTGTAGATAGAGAACAGCTGG - Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978881391 4:113707428-113707450 AAATAGAGATGGAGAACAGCTGG - Intronic
978898685 4:113923217-113923239 CTGTAGAGAAAGAGAACAGCAGG - Intronic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
982179514 4:152736800-152736822 CAATGAAGATGGAAAACAGCTGG + Intronic
983842114 4:172469898-172469920 CAGTAGTGAACGAGAAGAGCTGG + Intronic
983897055 4:173092426-173092448 CAGTAGAGTGGGAAAAGAGCTGG + Intergenic
984367198 4:178814587-178814609 CTGTGGAAATGAAGAACAGCTGG + Intergenic
984514863 4:180725600-180725622 CAGTAGAGATGGAGGACAACAGG + Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986074948 5:4326862-4326884 CAGCAGAGGTGGAGGGCAGCAGG - Intergenic
986412568 5:7495006-7495028 CAGCAGAGATGAGGAAAAGCTGG - Intronic
986764156 5:10908559-10908581 CAGAAGTGATGGAGCACAACTGG + Intergenic
987690860 5:21265145-21265167 CAGTGTACATTGAGAACAGCTGG - Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988509102 5:31850983-31851005 CTGTAGAGATGATGAACAGCTGG + Intronic
989296842 5:39838544-39838566 CAGGAGAGAGGGAGAACAAAGGG - Intergenic
989296919 5:39839292-39839314 CAGGAGAGAGGGAGAACAAGGGG - Intergenic
989688507 5:44115147-44115169 AATAAGAGATGGAGAAAAGCAGG + Intergenic
990659326 5:57995603-57995625 CAGTAGAGAGGTAGGCCAGCTGG - Intergenic
991247938 5:64527404-64527426 CAGTAGGGATTGAGAACTACTGG + Intronic
991288990 5:65012756-65012778 CTTCAGAGATGGAGAACAGCTGG - Intronic
991319182 5:65350276-65350298 CAGTGAAGATTGAGAACATCTGG + Intronic
993062480 5:83055339-83055361 CAGCAGAGCTGGACAACAGATGG + Exonic
993968813 5:94391362-94391384 CTGTATAAATGCAGAACAGCCGG + Intronic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
995612864 5:113928816-113928838 CAGTAGAGAGGGAAAAAAGCTGG - Intergenic
995932673 5:117468164-117468186 CAGAAAAGATGGAAAACAGCAGG + Intergenic
998182839 5:139957259-139957281 CAGTAGAGATGGGAACTAGCTGG + Intronic
998863655 5:146472562-146472584 GAAGAGAGATGGGGAACAGCCGG - Intronic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003682399 6:8269040-8269062 CAGTGGTGATGGAGAAAACCAGG + Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1004954840 6:20717884-20717906 CAGTAGAGAAGGAGAAAGGATGG + Intronic
1005036418 6:21559191-21559213 GAGCAGAGATGGAGAATATCAGG - Intergenic
1005588760 6:27302989-27303011 AAGTAAAAATGCAGAACAGCTGG + Intronic
1005928859 6:30466068-30466090 CCCTAGGGATGGAGAACAGAAGG + Intergenic
1006182443 6:32162518-32162540 CAGAAGAGCTGGAGAAAATCTGG - Intronic
1007298147 6:40844399-40844421 CACAGGAAATGGAGAACAGCAGG + Intergenic
1011092413 6:83620260-83620282 AAGAAGAGATGGAGATCAGAAGG - Intronic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1013360190 6:109386800-109386822 TATTAAAGTTGGAGAACAGCCGG + Intergenic
1013671358 6:112406882-112406904 CATTAGGGATGGAGAACGGCTGG + Intergenic
1014508302 6:122286772-122286794 CAATAGAGATAAAGAACAGATGG + Intergenic
1014886074 6:126782976-126782998 TAGTGGAGTTGGGGAACAGCTGG + Intergenic
1015284511 6:131470123-131470145 CAGTAGATACTGAGAAAAGCTGG - Intergenic
1015383166 6:132592860-132592882 CAGCAGAGAGGAAGAAGAGCCGG - Intergenic
1015594245 6:134851085-134851107 CAACAGAGATGCAGAGCAGCAGG + Intergenic
1016515160 6:144884898-144884920 CGAAAGAGAGGGAGAACAGCCGG - Intergenic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1016932551 6:149425279-149425301 CAGCAGAGATTGAGTACAGAAGG + Intergenic
1018593829 6:165456514-165456536 CAAAAGAGATGGAGAACAGCTGG - Intronic
1019155006 6:170032805-170032827 TGGTAGAGATGGAGAACTGGAGG - Intergenic
1019487813 7:1297313-1297335 CAGGAAAGATGGGGAACAGCTGG + Intergenic
1019653115 7:2171477-2171499 CAGCAGAGAAGGACAGCAGCCGG + Intronic
1019919318 7:4152969-4152991 CAGTAGAGAGGAAGAAGAGAAGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021905799 7:25331910-25331932 CATTAGAGATGAAGAAAAGGAGG - Intergenic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022255224 7:28649455-28649477 CAGTTGCAATGGAGAACAGATGG + Intronic
1025233555 7:57218798-57218820 CAGTAGACCTGGGGAAGAGCCGG + Intergenic
1025727001 7:64073981-64074003 CAGGAGAGATCTAGAACAGTGGG - Intronic
1026297793 7:69070448-69070470 CAGCAGAGAGAGAGAGCAGCAGG + Intergenic
1028447632 7:90943245-90943267 ACGTAGAGATGGAGAAGAGGTGG + Intronic
1029578839 7:101421355-101421377 CAGTAGACTTGGAGTAAAGCAGG - Intronic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1030527185 7:110668365-110668387 CAGCAGAGTTGGAAAACAGCTGG + Intronic
1032193411 7:129777103-129777125 CCTTAGAGCTGGAGAACAGATGG + Intergenic
1032431462 7:131865283-131865305 GTCTAGAGATGGAGAACATCTGG - Intergenic
1032998881 7:137480937-137480959 AGGTAGGGATGGAGAACAGAAGG - Intronic
1033028744 7:137804200-137804222 CAGTAGAGAGGGGGAAGAGATGG - Intronic
1034255936 7:149724712-149724734 CTGTGAAGATGGAGAACAGCTGG + Exonic
1035215189 7:157360776-157360798 CAGGAGAGATGCAGAACAGGTGG - Intronic
1038389256 8:27179945-27179967 GAGTACATAGGGAGAACAGCTGG - Intergenic
1038440671 8:27569074-27569096 CAGTAGAGATGGGGAAAGGGAGG - Intergenic
1038834701 8:31106449-31106471 CAGTAGAGAATGAGATCAGAGGG - Intronic
1038904772 8:31887770-31887792 CAGTCGAGTTGTAGAATAGCTGG - Intronic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039518739 8:38153650-38153672 CAATAGAGAAGGAGCACACCAGG - Intergenic
1039793429 8:40893084-40893106 TGCTGGAGATGGAGAACAGCTGG + Intronic
1040466370 8:47699411-47699433 TAACAGAGATGGGGAACAGCAGG - Intronic
1042388470 8:68204576-68204598 CAGCAGAGATGGGTAACAGCTGG - Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044113192 8:88302463-88302485 CAGTGGAGAAGGAGTACAACAGG - Intronic
1044164301 8:88962212-88962234 GAAGAGAGATGGGGAACAGCTGG + Intergenic
1045073609 8:98538527-98538549 CATTGGAGATTGAAAACAGCTGG - Intronic
1045271266 8:100663771-100663793 GACTAGAGATGCAGAAAAGCTGG - Intergenic
1046421822 8:113995303-113995325 CAGTAGAAATGGAAAACAGCTGG - Intergenic
1046551878 8:115728428-115728450 CAGTAGAGATGGATTTCAGTGGG + Intronic
1046852439 8:118990130-118990152 CAGTAGAGATGTAATACAGTTGG - Intergenic
1047513638 8:125534708-125534730 CAGGAGAGATGGTGCCCAGCAGG + Intergenic
1048462239 8:134630688-134630710 CTGTAGTTATGTAGAACAGCTGG - Intronic
1049038006 8:140091662-140091684 CAGCAGAGATGAAAGACAGCAGG + Intronic
1049171764 8:141165901-141165923 AGGAAGAGATGGAAAACAGCAGG - Intronic
1049325203 8:142017993-142018015 CAGTAGCCATGGAGGGCAGCTGG - Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049629129 8:143642706-143642728 AGGGAGAGATGGGGAACAGCCGG + Intronic
1050213482 9:3291844-3291866 CAAAAGAGATGGAGACCATCTGG + Intronic
1050220794 9:3387458-3387480 CAGTAGAGATGGTCAACAAAAGG + Intronic
1050565303 9:6875991-6876013 CAGTAGAGAAAGAGAACATAGGG + Intronic
1050589618 9:7148451-7148473 CAGTAGCAGTGGAGAACAGGAGG + Intergenic
1050648515 9:7748694-7748716 CAGTGAAGACAGAGAACAGCAGG + Intergenic
1051220981 9:14847937-14847959 CAGCAGAGATAGAGAACATCAGG - Intronic
1051400240 9:16673286-16673308 CAGTATAGCTGGAAGACAGCAGG + Intronic
1052592841 9:30520664-30520686 AAGTAGATGTGGAGAAGAGCAGG + Intergenic
1054710611 9:68507325-68507347 CATTAGTTATGGAGAACAGCTGG - Intronic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1058638451 9:107059442-107059464 CAGCAGAGATGCTGAACAGTAGG + Intergenic
1058890196 9:109354797-109354819 AATGAGGGATGGAGAACAGCTGG - Intergenic
1059973195 9:119688792-119688814 GGGTAGAAAGGGAGAACAGCTGG - Intergenic
1186455169 X:9704967-9704989 CAGTAGGGAGGGAGGACATCTGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187612728 X:20960299-20960321 CATTAGAAATAGACAACAGCAGG + Intergenic
1187717037 X:22113099-22113121 CAGTAGGGGTGGAAAGCAGCTGG - Intronic
1188417143 X:29949517-29949539 CAGCAGAGATGAAAAACAGCTGG - Intronic
1188602964 X:31992045-31992067 AAGTGGAGAGTGAGAACAGCAGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191641719 X:63434073-63434095 GAGAAGGGATGGAGAAGAGCCGG + Intergenic
1192221598 X:69200936-69200958 CAGTGAAGATGGAAAACAGCTGG - Intergenic
1192298810 X:69879279-69879301 CTGTAGAGAGGGAGAAGATCAGG - Intronic
1194568309 X:95521494-95521516 CAGTAGAAAGGGAGAAAAGGAGG + Intergenic
1194748336 X:97654953-97654975 CAGTAGAGATGGAAGAAAACTGG - Intergenic
1195100114 X:101547375-101547397 CAGCTGAGATGAAGAAAAGCAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195637365 X:107133250-107133272 CAGTAGGAATGGAAGACAGCAGG - Intronic
1195789761 X:108570881-108570903 CAGTAGTGAGTGAGAAAAGCTGG + Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198645654 X:138803088-138803110 CATTAGAGTTGGAGAAATGCAGG - Intronic
1198740882 X:139841442-139841464 GAGTAGAGAAGGAGAACTGCAGG + Intronic
1198786624 X:140295868-140295890 CAGCAAAGATGGAAAACAACTGG + Intergenic
1199089551 X:143675514-143675536 AAGCAGAGATGGTGAACAGGTGG + Intergenic
1199226100 X:145376536-145376558 TAGTAGAGATGGAGACAAGGAGG + Intergenic
1201553559 Y:15244541-15244563 CAGAATAGATGGAGGACAGATGG + Intergenic