ID: 1158389640

View in Genome Browser
Species Human (GRCh38)
Location 18:57034552-57034574
Sequence CGTGCCAGAGGCTGTCCATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158389640_1158389643 9 Left 1158389640 18:57034552-57034574 CCTCATGGACAGCCTCTGGCACG 0: 1
1: 0
2: 1
3: 20
4: 298
Right 1158389643 18:57034584-57034606 ACAATTGTTAAAACTTTCCTTGG 0: 1
1: 0
2: 0
3: 49
4: 372
1158389640_1158389644 23 Left 1158389640 18:57034552-57034574 CCTCATGGACAGCCTCTGGCACG 0: 1
1: 0
2: 1
3: 20
4: 298
Right 1158389644 18:57034598-57034620 TTTCCTTGGTGATGCTTGTATGG 0: 1
1: 0
2: 1
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158389640 Original CRISPR CGTGCCAGAGGCTGTCCATG AGG (reversed) Exonic