ID: 1158394362

View in Genome Browser
Species Human (GRCh38)
Location 18:57068194-57068216
Sequence GGGACCTGAACAATCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158394355_1158394362 22 Left 1158394355 18:57068149-57068171 CCTGGGCAGGGACAAATCTTCGA No data
Right 1158394362 18:57068194-57068216 GGGACCTGAACAATCCCTGAGGG No data
1158394354_1158394362 27 Left 1158394354 18:57068144-57068166 CCAGTCCTGGGCAGGGACAAATC No data
Right 1158394362 18:57068194-57068216 GGGACCTGAACAATCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158394362 Original CRISPR GGGACCTGAACAATCCCTGA GGG Intergenic
No off target data available for this crispr