ID: 1158395112

View in Genome Browser
Species Human (GRCh38)
Location 18:57073205-57073227
Sequence ATCCAGGAGGTAAGAGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158395112_1158395119 -4 Left 1158395112 18:57073205-57073227 CCCTGTCCTCTTACCTCCTGGAT No data
Right 1158395119 18:57073224-57073246 GGATGAGGAAGCTGAGGATGAGG No data
1158395112_1158395117 -10 Left 1158395112 18:57073205-57073227 CCCTGTCCTCTTACCTCCTGGAT No data
Right 1158395117 18:57073218-57073240 CCTCCTGGATGAGGAAGCTGAGG No data
1158395112_1158395120 -3 Left 1158395112 18:57073205-57073227 CCCTGTCCTCTTACCTCCTGGAT No data
Right 1158395120 18:57073225-57073247 GATGAGGAAGCTGAGGATGAGGG No data
1158395112_1158395121 28 Left 1158395112 18:57073205-57073227 CCCTGTCCTCTTACCTCCTGGAT No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158395112 Original CRISPR ATCCAGGAGGTAAGAGGACA GGG (reversed) Intergenic