ID: 1158395113

View in Genome Browser
Species Human (GRCh38)
Location 18:57073206-57073228
Sequence CATCCAGGAGGTAAGAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158395113_1158395120 -4 Left 1158395113 18:57073206-57073228 CCTGTCCTCTTACCTCCTGGATG No data
Right 1158395120 18:57073225-57073247 GATGAGGAAGCTGAGGATGAGGG No data
1158395113_1158395119 -5 Left 1158395113 18:57073206-57073228 CCTGTCCTCTTACCTCCTGGATG No data
Right 1158395119 18:57073224-57073246 GGATGAGGAAGCTGAGGATGAGG No data
1158395113_1158395121 27 Left 1158395113 18:57073206-57073228 CCTGTCCTCTTACCTCCTGGATG No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158395113 Original CRISPR CATCCAGGAGGTAAGAGGAC AGG (reversed) Intergenic
No off target data available for this crispr