ID: 1158395115

View in Genome Browser
Species Human (GRCh38)
Location 18:57073211-57073233
Sequence TTCCTCATCCAGGAGGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158395115_1158395120 -9 Left 1158395115 18:57073211-57073233 CCTCTTACCTCCTGGATGAGGAA No data
Right 1158395120 18:57073225-57073247 GATGAGGAAGCTGAGGATGAGGG No data
1158395115_1158395121 22 Left 1158395115 18:57073211-57073233 CCTCTTACCTCCTGGATGAGGAA No data
Right 1158395121 18:57073256-57073278 TGACTCATGTCATGTTCCATTGG No data
1158395115_1158395119 -10 Left 1158395115 18:57073211-57073233 CCTCTTACCTCCTGGATGAGGAA No data
Right 1158395119 18:57073224-57073246 GGATGAGGAAGCTGAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158395115 Original CRISPR TTCCTCATCCAGGAGGTAAG AGG (reversed) Intergenic